Incidental Mutation 'R6616:Ncoa5'
ID524032
Institutional Source Beutler Lab
Gene Symbol Ncoa5
Ensembl Gene ENSMUSG00000039804
Gene Namenuclear receptor coactivator 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location165000357-165034867 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 165010563 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 130 (Y130*)
Ref Sequence ENSEMBL: ENSMUSP00000113166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040381] [ENSMUST00000121377] [ENSMUST00000122070] [ENSMUST00000153905]
Predicted Effect probably null
Transcript: ENSMUST00000040381
AA Change: Y130*
SMART Domains Protein: ENSMUSP00000046388
Gene: ENSMUSG00000039804
AA Change: Y130*

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 2e-9 SMART
PDB:1V95|A 197 314 3e-79 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 395 427 N/A INTRINSIC
low complexity region 440 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121377
SMART Domains Protein: ENSMUSP00000113872
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
PDB:1V95|A 1 34 2e-15 PDB
low complexity region 44 60 N/A INTRINSIC
low complexity region 87 96 N/A INTRINSIC
low complexity region 115 147 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122070
AA Change: Y130*
SMART Domains Protein: ENSMUSP00000113166
Gene: ENSMUSG00000039804
AA Change: Y130*

DomainStartEndE-ValueType
low complexity region 46 79 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
low complexity region 107 118 N/A INTRINSIC
coiled coil region 163 190 N/A INTRINSIC
SCOP:d1kmma1 195 287 1e-8 SMART
PDB:1V95|A 197 314 2e-80 PDB
low complexity region 324 340 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127545
Predicted Effect probably benign
Transcript: ENSMUST00000153905
SMART Domains Protein: ENSMUSP00000116778
Gene: ENSMUSG00000039804

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coregulator for the alpha and beta estrogen receptors and the orphan nuclear receptor NR1D2. The protein localizes to the nucleus, and is thought to have both coactivator and corepressor functions. Its interaction with nuclear receptors is independent of the AF2 domain on the receptors, which is known to regulate interaction with other coreceptors. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Male mice heterozygous for a knock-out allele exhibit infertility, impaired glucose homeostasis, liver dysplasia and HCC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Ncoa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02285:Ncoa5 APN 2 165002840 missense probably damaging 1.00
IGL02624:Ncoa5 APN 2 165013061 missense probably damaging 0.99
R0383:Ncoa5 UTSW 2 165009390 missense possibly damaging 0.67
R0835:Ncoa5 UTSW 2 165002794 missense probably damaging 1.00
R1667:Ncoa5 UTSW 2 165001703 missense probably damaging 1.00
R2110:Ncoa5 UTSW 2 165012918 missense possibly damaging 0.59
R4887:Ncoa5 UTSW 2 165002150 missense probably damaging 1.00
R5100:Ncoa5 UTSW 2 165009389 missense probably damaging 0.99
R5631:Ncoa5 UTSW 2 165013121 missense possibly damaging 0.90
R6737:Ncoa5 UTSW 2 165002135 missense probably damaging 1.00
R7015:Ncoa5 UTSW 2 165002081 missense probably benign 0.02
R7567:Ncoa5 UTSW 2 165004251 missense possibly damaging 0.83
R7840:Ncoa5 UTSW 2 165012896 missense possibly damaging 0.66
R8289:Ncoa5 UTSW 2 165013062 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATTAACATCTGTGGACTGCCTGG -3'
(R):5'- AGACTGTGAACACGTCCTGC -3'

Sequencing Primer
(F):5'- AGGTGCTGGTGTCCACAAATC -3'
(R):5'- CTGCATATAACCCTGCATGGTAG -3'
Posted On2018-06-22