Incidental Mutation 'R6508:Mcat'
ID524035
Institutional Source Beutler Lab
Gene Symbol Mcat
Ensembl Gene ENSMUSG00000048755
Gene Namemalonyl CoA:ACP acyltransferase (mitochondrial)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location83546797-83563787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83549251 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 34 (Q34R)
Ref Sequence ENSEMBL: ENSMUSP00000155738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016902] [ENSMUST00000061882] [ENSMUST00000229724] [ENSMUST00000229964] [ENSMUST00000230912]
Predicted Effect probably benign
Transcript: ENSMUST00000016902
SMART Domains Protein: ENSMUSP00000016902
Gene: ENSMUSG00000016758

DomainStartEndE-ValueType
Pfam:bcl-2I13 1 149 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061882
AA Change: Q197R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051569
Gene: ENSMUSG00000048755
AA Change: Q197R

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:Acyl_transf_1 62 342 5.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229177
Predicted Effect probably benign
Transcript: ENSMUST00000229724
AA Change: Q34R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230094
Predicted Effect probably benign
Transcript: ENSMUST00000230672
Predicted Effect probably benign
Transcript: ENSMUST00000230851
Predicted Effect probably benign
Transcript: ENSMUST00000230912
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found exclusively in the mitochondrion, where it catalyzes the transfer of a malonyl group from malonyl-CoA to the mitochondrial acyl carrier protein. The encoded protein may be part of a fatty acid synthase complex that is more like the type II prokaryotic and plastid complexes rather than the type I human cytosolic complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated ubiquitously consume more food, fail to gain weight, are less physically active, and suffer from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Mcat
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0569:Mcat UTSW 15 83549248 missense probably benign 0.00
R1497:Mcat UTSW 15 83549252 nonsense probably null
R5518:Mcat UTSW 15 83547674 unclassified probably null
R5909:Mcat UTSW 15 83547915 missense probably benign 0.20
R6582:Mcat UTSW 15 83549182 missense probably benign 0.00
R6964:Mcat UTSW 15 83547931 unclassified probably benign
R7599:Mcat UTSW 15 83547671 missense probably damaging 1.00
R7814:Mcat UTSW 15 83547909 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCACAAGGAATGACTCCCTG -3'
(R):5'- ATAACTAAAACTGTGGCCCTGG -3'

Sequencing Primer
(F):5'- TGCAGCACAACGGACTG -3'
(R):5'- CTGGGGCTGGCAGTCAG -3'
Posted On2018-06-22