Incidental Mutation 'R6616:Fnip2'
ID524038
Institutional Source Beutler Lab
Gene Symbol Fnip2
Ensembl Gene ENSMUSG00000061175
Gene Namefolliculin interacting protein 2
SynonymsD630023B12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location79455974-79567796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 79480882 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 847 (H847Q)
Ref Sequence ENSEMBL: ENSMUSP00000115275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076136] [ENSMUST00000133154]
Predicted Effect probably benign
Transcript: ENSMUST00000076136
AA Change: H817Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075497
Gene: ENSMUSG00000061175
AA Change: H817Q

DomainStartEndE-ValueType
Pfam:FNIP_N 42 168 4.3e-39 PFAM
low complexity region 240 261 N/A INTRINSIC
Pfam:FNIP_M 289 528 5.9e-92 PFAM
low complexity region 557 571 N/A INTRINSIC
low complexity region 748 755 N/A INTRINSIC
Pfam:FNIP_C 920 1104 4.1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133154
AA Change: H847Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115275
Gene: ENSMUSG00000061175
AA Change: H847Q

DomainStartEndE-ValueType
Pfam:FNIP_N 42 164 5.2e-34 PFAM
low complexity region 270 291 N/A INTRINSIC
Pfam:FNIP_M 323 557 3.9e-93 PFAM
low complexity region 587 601 N/A INTRINSIC
low complexity region 778 785 N/A INTRINSIC
Pfam:FNIP_C 951 1134 2.3e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154645
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in regulating the O6-methylguanine-induced apoptosis signaling pathway. This protein may also play a role cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 1, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele have normal lifespans. Mice with combined loss of this gene and a single null allele of Fnip1 develop kidney cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Fnip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Fnip2 APN 3 79481521 missense probably benign
IGL00339:Fnip2 APN 3 79515155 missense probably benign 0.12
IGL00340:Fnip2 APN 3 79518061 splice site probably benign
IGL00434:Fnip2 APN 3 79512489 splice site probably benign
IGL01134:Fnip2 APN 3 79512503 nonsense probably null
IGL02732:Fnip2 APN 3 79465697 missense probably damaging 1.00
IGL03327:Fnip2 APN 3 79518081 missense probably damaging 0.98
IGL03402:Fnip2 APN 3 79481276 missense possibly damaging 0.92
R0314:Fnip2 UTSW 3 79481189 missense probably damaging 1.00
R0318:Fnip2 UTSW 3 79512378 missense probably damaging 1.00
R0699:Fnip2 UTSW 3 79481139 missense probably benign 0.00
R1188:Fnip2 UTSW 3 79462162 missense probably damaging 1.00
R1290:Fnip2 UTSW 3 79465693 missense probably damaging 1.00
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1406:Fnip2 UTSW 3 79508091 missense possibly damaging 0.85
R1535:Fnip2 UTSW 3 79481765 missense probably damaging 1.00
R1618:Fnip2 UTSW 3 79508168 missense possibly damaging 0.70
R1661:Fnip2 UTSW 3 79515149 missense probably benign
R1665:Fnip2 UTSW 3 79515149 missense probably benign
R1965:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1966:Fnip2 UTSW 3 79493472 missense probably benign 0.31
R1976:Fnip2 UTSW 3 79480931 missense probably benign 0.02
R2004:Fnip2 UTSW 3 79512325 splice site probably benign
R2054:Fnip2 UTSW 3 79572465 unclassified probably benign
R2145:Fnip2 UTSW 3 79500432 missense probably damaging 0.99
R2400:Fnip2 UTSW 3 79479634 missense probably benign 0.03
R2679:Fnip2 UTSW 3 79480926 missense probably benign 0.13
R3157:Fnip2 UTSW 3 79567594 missense probably damaging 1.00
R3851:Fnip2 UTSW 3 79462157 missense probably damaging 1.00
R3910:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3911:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R3912:Fnip2 UTSW 3 79479505 missense possibly damaging 0.83
R4035:Fnip2 UTSW 3 79479501 missense probably benign 0.00
R4166:Fnip2 UTSW 3 79462135 missense probably damaging 1.00
R4537:Fnip2 UTSW 3 79465714 missense probably damaging 0.98
R4732:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4733:Fnip2 UTSW 3 79481652 missense probably damaging 1.00
R4774:Fnip2 UTSW 3 79465721 nonsense probably null
R4923:Fnip2 UTSW 3 79489394 critical splice acceptor site probably null
R5043:Fnip2 UTSW 3 79492867 nonsense probably null
R5160:Fnip2 UTSW 3 79488991 missense probably damaging 1.00
R5162:Fnip2 UTSW 3 79481777 missense probably damaging 1.00
R5196:Fnip2 UTSW 3 79572538 unclassified probably benign
R5283:Fnip2 UTSW 3 79465708 missense probably damaging 1.00
R5364:Fnip2 UTSW 3 79481168 missense probably benign 0.00
R5402:Fnip2 UTSW 3 79480943 missense possibly damaging 0.89
R6340:Fnip2 UTSW 3 79507845 missense probably damaging 1.00
R6459:Fnip2 UTSW 3 79481634 missense possibly damaging 0.93
R6592:Fnip2 UTSW 3 79481708 missense probably benign 0.26
R6933:Fnip2 UTSW 3 79518111 missense probably benign 0.28
R6962:Fnip2 UTSW 3 79489303 missense probably damaging 1.00
R6971:Fnip2 UTSW 3 79481121 nonsense probably null
R7050:Fnip2 UTSW 3 79506270 missense probably damaging 0.99
R7097:Fnip2 UTSW 3 79481006 missense probably benign
R7315:Fnip2 UTSW 3 79506205 critical splice donor site probably null
R7714:Fnip2 UTSW 3 79518114 missense probably damaging 1.00
R7782:Fnip2 UTSW 3 79508123 missense probably benign 0.00
R8381:Fnip2 UTSW 3 79465693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTTGCCCTTACCACTGG -3'
(R):5'- GGACATTTCCATGGGGCTAGTG -3'

Sequencing Primer
(F):5'- TTACCACTGGCATCCCCATAGG -3'
(R):5'- AGCTCTAGCATGGACACTGG -3'
Posted On2018-06-22