Incidental Mutation 'R6616:Zswim5'
ID524044
Institutional Source Beutler Lab
Gene Symbol Zswim5
Ensembl Gene ENSMUSG00000033948
Gene Namezinc finger SWIM-type containing 5
Synonyms4933426E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116877376-116989264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116986741 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 992 (D992G)
Ref Sequence ENSEMBL: ENSMUSP00000049474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030446] [ENSMUST00000044823] [ENSMUST00000130273]
Predicted Effect probably benign
Transcript: ENSMUST00000030446
SMART Domains Protein: ENSMUSP00000030446
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 14 360 2.4e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000044823
AA Change: D992G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049474
Gene: ENSMUSG00000033948
AA Change: D992G

DomainStartEndE-ValueType
low complexity region 35 56 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
low complexity region 692 708 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130273
SMART Domains Protein: ENSMUSP00000116154
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 1 64 1.2e-18 PFAM
Pfam:URO-D 60 120 4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150370
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Other mutations in Zswim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Zswim5 APN 4 116985736 missense possibly damaging 0.93
IGL01700:Zswim5 APN 4 116986461 unclassified probably benign
IGL01975:Zswim5 APN 4 116965692 missense probably benign 0.03
IGL02334:Zswim5 APN 4 116986644 missense probably damaging 1.00
IGL02505:Zswim5 APN 4 116962552 missense probably benign 0.43
IGL02712:Zswim5 APN 4 116985695 missense probably damaging 0.99
PIT4243001:Zswim5 UTSW 4 116984778 missense probably benign 0.10
R0324:Zswim5 UTSW 4 116986906 missense probably damaging 1.00
R0611:Zswim5 UTSW 4 116986677 unclassified probably null
R0730:Zswim5 UTSW 4 116985746 missense possibly damaging 0.75
R1663:Zswim5 UTSW 4 116986895 missense probably damaging 1.00
R1843:Zswim5 UTSW 4 116877699 missense unknown
R2070:Zswim5 UTSW 4 116979912 missense probably benign 0.14
R2176:Zswim5 UTSW 4 116973041 missense probably damaging 0.99
R3715:Zswim5 UTSW 4 116962558 missense probably benign 0.21
R4044:Zswim5 UTSW 4 116986702 missense probably damaging 1.00
R4063:Zswim5 UTSW 4 116877980 missense unknown
R4118:Zswim5 UTSW 4 116986819 missense possibly damaging 0.93
R4612:Zswim5 UTSW 4 116986704 missense probably damaging 1.00
R4782:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4799:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4983:Zswim5 UTSW 4 116985686 missense possibly damaging 0.60
R5294:Zswim5 UTSW 4 116979577 missense possibly damaging 0.93
R5836:Zswim5 UTSW 4 116984803 missense probably benign 0.27
R6025:Zswim5 UTSW 4 116950909 missense probably damaging 1.00
R6041:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6042:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6043:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6159:Zswim5 UTSW 4 116979679 missense probably damaging 1.00
R6198:Zswim5 UTSW 4 116878007 missense probably benign 0.13
R6415:Zswim5 UTSW 4 116980866 missense possibly damaging 0.89
R6442:Zswim5 UTSW 4 116951005 missense probably damaging 1.00
R6547:Zswim5 UTSW 4 116986903 missense probably damaging 1.00
R6745:Zswim5 UTSW 4 116975204 missense probably damaging 1.00
R7144:Zswim5 UTSW 4 116975976 critical splice donor site probably null
R7260:Zswim5 UTSW 4 116962646 missense probably damaging 1.00
R7300:Zswim5 UTSW 4 116975905 missense probably damaging 1.00
R7310:Zswim5 UTSW 4 116984688 missense probably benign 0.01
R7326:Zswim5 UTSW 4 116980834 missense possibly damaging 0.75
R7429:Zswim5 UTSW 4 116975857 missense possibly damaging 0.87
R7430:Zswim5 UTSW 4 116975857 missense possibly damaging 0.87
R7607:Zswim5 UTSW 4 116986742 missense possibly damaging 0.93
R7811:Zswim5 UTSW 4 116877476 missense unknown
R7993:Zswim5 UTSW 4 116951094 missense probably benign 0.10
R8221:Zswim5 UTSW 4 116878022 missense probably benign 0.09
R8341:Zswim5 UTSW 4 116986792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGGTACACACTCTTCACC -3'
(R):5'- CCCAGAGCACATCATTGATGG -3'

Sequencing Primer
(F):5'- CCCGACTGAGGCTACAAGTATTG -3'
(R):5'- AGCACATCATTGATGGCTGGATG -3'
Posted On2018-06-22