Incidental Mutation 'R6616:Zfp990'
ID524046
Institutional Source Beutler Lab
Gene Symbol Zfp990
Ensembl Gene ENSMUSG00000078503
Gene Namezinc finger protein 990
SynonymsGm13225
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location145510759-145539188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145537145 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 238 (I238L)
Ref Sequence ENSEMBL: ENSMUSP00000101368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105741] [ENSMUST00000105742] [ENSMUST00000136309]
Predicted Effect probably benign
Transcript: ENSMUST00000105741
AA Change: I238L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101367
Gene: ENSMUSG00000078503
AA Change: I238L

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105742
AA Change: I238L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101368
Gene: ENSMUSG00000078503
AA Change: I238L

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136309
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Zfp990
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Zfp990 APN 4 145537868 missense probably damaging 0.99
IGL01774:Zfp990 APN 4 145536948 missense probably benign 0.28
IGL01895:Zfp990 APN 4 145536857 missense probably damaging 0.97
IGL01895:Zfp990 APN 4 145536858 missense probably damaging 0.99
IGL02349:Zfp990 APN 4 145530877 utr 5 prime probably benign
IGL02598:Zfp990 APN 4 145536963 missense possibly damaging 0.67
IGL02940:Zfp990 APN 4 145534922 splice site probably null
IGL03026:Zfp990 APN 4 145537110 missense possibly damaging 0.54
R0007:Zfp990 UTSW 4 145537438 missense probably benign 0.00
R0352:Zfp990 UTSW 4 145536604 missense probably damaging 0.99
R0631:Zfp990 UTSW 4 145537302 missense possibly damaging 0.89
R1490:Zfp990 UTSW 4 145537283 missense probably benign 0.44
R1537:Zfp990 UTSW 4 145536996 missense possibly damaging 0.67
R1832:Zfp990 UTSW 4 145538210 missense possibly damaging 0.51
R1956:Zfp990 UTSW 4 145534882 missense probably damaging 1.00
R1982:Zfp990 UTSW 4 145536869 missense probably damaging 0.99
R2024:Zfp990 UTSW 4 145537404 missense possibly damaging 0.69
R2097:Zfp990 UTSW 4 145537322 missense possibly damaging 0.94
R2235:Zfp990 UTSW 4 145537891 missense probably damaging 0.99
R4194:Zfp990 UTSW 4 145536977 splice site probably null
R4195:Zfp990 UTSW 4 145536977 splice site probably null
R4418:Zfp990 UTSW 4 145536728 missense possibly damaging 0.87
R4617:Zfp990 UTSW 4 145537046 missense possibly damaging 0.59
R4736:Zfp990 UTSW 4 145536942 missense possibly damaging 0.95
R4880:Zfp990 UTSW 4 145537920 missense probably benign
R4941:Zfp990 UTSW 4 145536837 missense probably damaging 1.00
R5014:Zfp990 UTSW 4 145538099 missense possibly damaging 0.93
R5945:Zfp990 UTSW 4 145538043 missense probably damaging 0.98
R6238:Zfp990 UTSW 4 145537913 missense probably damaging 1.00
R6255:Zfp990 UTSW 4 145537789 missense probably benign 0.00
R6267:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6296:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6412:Zfp990 UTSW 4 145537568 missense probably benign 0.00
R6701:Zfp990 UTSW 4 145538178 missense probably benign 0.45
R6720:Zfp990 UTSW 4 145536927 missense possibly damaging 0.67
R7015:Zfp990 UTSW 4 145536635 missense probably damaging 0.99
R7487:Zfp990 UTSW 4 145537587 missense probably damaging 1.00
R7722:Zfp990 UTSW 4 145536962 missense possibly damaging 0.86
Z1176:Zfp990 UTSW 4 145536811 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCAGGAACACTAAAGAAGTTTG -3'
(R):5'- GGGTAAAGCATTTGTCACATTCAC -3'

Sequencing Primer
(F):5'- GTGTCAATCAAGGAATTTACATGCAG -3'
(R):5'- GCATTTGTCACATTCACTACATTTG -3'
Posted On2018-06-22