Mutagenetix > Incidental Mutation

Incidental Mutation 'R6616:Grin2b'

524052

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b

MMRRC Submission

044739-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6616 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135690231-136150509 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 135709549 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1332 (D1332E)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053880
AA Change: D1332E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: D1332E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111905
AA Change: D1332E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: D1332E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136027

Meta Mutation Damage Score

0.0625

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	T	17: 24,603,509 (GRCm39)	H567L	probably damaging	Het
Adck1	T	A	12: 88,427,958 (GRCm39)	M525K	unknown	Het
Alpi	T	C	1: 87,028,836 (GRCm39)	I74V	possibly damaging	Het
Ccdc168	C	A	1: 44,100,634 (GRCm39)	V155L	possibly damaging	Het
Creb5	A	C	6: 53,662,295 (GRCm39)	Q197H	possibly damaging	Het
Cyp2b13	A	G	7: 25,785,306 (GRCm39)	K225R	probably benign	Het
Dock1	G	A	7: 134,710,221 (GRCm39)	E1143K	possibly damaging	Het
Eef2kmt	T	A	16: 5,065,346 (GRCm39)	D287V	probably damaging	Het
Eif2ak4	T	A	2: 118,285,326 (GRCm39)	Y1046*	probably null	Het
Fbxw10	T	A	11: 62,743,850 (GRCm39)	M252K	probably benign	Het
Fnip2	A	C	3: 79,388,189 (GRCm39)	H847Q	probably benign	Het
Frmd3	A	T	4: 74,105,725 (GRCm39)	D457V	probably damaging	Het
Gm13941	T	G	2: 110,931,520 (GRCm39)	E37D	unknown	Het
Grin1	T	A	2: 25,182,122 (GRCm39)	I870F	possibly damaging	Het
Gtpbp4	G	A	13: 9,039,141 (GRCm39)	T201I	possibly damaging	Het
Heatr4	A	G	12: 84,026,904 (GRCm39)	C118R	probably benign	Het
Hltf	T	A	3: 20,163,651 (GRCm39)		probably null	Het
Hmcn1	C	T	1: 150,599,008 (GRCm39)		probably null	Het
Hpd	A	T	5: 123,310,123 (GRCm39)	L367Q	probably damaging	Het
Htr1b	A	G	9: 81,514,487 (GRCm39)	I40T	probably benign	Het
Il16	A	G	7: 83,295,684 (GRCm39)	S464P	probably benign	Het
Lrp1b	T	A	2: 40,589,643 (GRCm39)	D75V	unknown	Het
Map3k4	A	T	17: 12,490,231 (GRCm39)	L400Q	probably damaging	Het
Mcts2	T	A	2: 152,529,582 (GRCm39)	I131N	possibly damaging	Het
Mroh2b	A	C	15: 4,982,764 (GRCm39)	I1528L	probably benign	Het
Muc4	A	C	16: 32,602,378 (GRCm39)	D3467A	possibly damaging	Het
Mypn	A	T	10: 63,005,091 (GRCm39)	C339S	probably damaging	Het
Ncoa5	A	T	2: 164,852,483 (GRCm39)	Y130*	probably null	Het
Or11g27	T	A	14: 50,771,364 (GRCm39)	I165N	probably benign	Het
Or2y11	T	A	11: 49,442,868 (GRCm39)	V98E	probably damaging	Het
Pcdha4	A	G	18: 37,086,953 (GRCm39)	T379A	probably benign	Het
Pkp4	C	G	2: 59,180,896 (GRCm39)	Y720*	probably null	Het
Prl5a1	C	T	13: 28,333,839 (GRCm39)	T114I	probably benign	Het
Rnd3	A	G	2: 51,024,169 (GRCm39)	S137P	probably damaging	Het
Rtel1	G	A	2: 180,994,579 (GRCm39)	E680K	possibly damaging	Het
Sbsn	T	A	7: 30,452,704 (GRCm39)	V573D	possibly damaging	Het
Scaf8	A	T	17: 3,218,330 (GRCm39)	L233F	unknown	Het
Sec23a	A	T	12: 59,043,941 (GRCm39)	I241K	possibly damaging	Het
Secisbp2l	A	T	2: 125,610,146 (GRCm39)	S258T	probably damaging	Het
Skint4	A	G	4: 111,975,427 (GRCm39)	H121R	possibly damaging	Het
Sptbn1	T	A	11: 30,074,030 (GRCm39)	E1346D	probably benign	Het
Srsf11	C	T	3: 157,728,981 (GRCm39)		probably benign	Het
Stpg4	A	G	17: 87,730,124 (GRCm39)	Y74H	probably damaging	Het
Tenm4	G	A	7: 96,202,703 (GRCm39)	R106H	probably benign	Het
Tmc4	A	G	7: 3,674,057 (GRCm39)	V374A	possibly damaging	Het
Unc45b	G	A	11: 82,802,645 (GRCm39)	R47Q	probably damaging	Het
Xirp1	A	G	9: 119,848,080 (GRCm39)	S268P	probably damaging	Het
Zfp990	A	T	4: 145,263,715 (GRCm39)	I238L	probably benign	Het
Zswim5	A	G	4: 116,843,938 (GRCm39)	D992G	possibly damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135,713,329 (GRCm39)	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135,710,568 (GRCm39)	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135,713,361 (GRCm39)	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136,021,263 (GRCm39)	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135,710,379 (GRCm39)	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135,710,738 (GRCm39)	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135,709,584 (GRCm39)	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135,713,470 (GRCm39)	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135,716,088 (GRCm39)	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136,020,906 (GRCm39)	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135,900,389 (GRCm39)	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135,756,367 (GRCm39)	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135,899,996 (GRCm39)	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135,716,130 (GRCm39)	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135,716,113 (GRCm39)	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135,757,253 (GRCm39)	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0055:Grin2b	UTSW	6	135,900,201 (GRCm39)	missense	probably benign
R0164:Grin2b	UTSW	6	135,755,646 (GRCm39)	splice site	probably benign
R0194:Grin2b	UTSW	6	135,756,303 (GRCm39)	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135,710,927 (GRCm39)	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135,820,193 (GRCm39)	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136,021,044 (GRCm39)	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135,709,730 (GRCm39)	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136,021,209 (GRCm39)	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135,710,243 (GRCm39)	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135,710,894 (GRCm39)	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135,757,138 (GRCm39)	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135,755,698 (GRCm39)	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135,710,180 (GRCm39)	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135,710,427 (GRCm39)	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135,717,951 (GRCm39)	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,710,637 (GRCm39)	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135,709,453 (GRCm39)	small deletion	probably benign
R3418:Grin2b	UTSW	6	135,820,108 (GRCm39)	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135,900,269 (GRCm39)	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135,713,433 (GRCm39)	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135,755,739 (GRCm39)	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135,710,823 (GRCm39)	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135,751,870 (GRCm39)	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135,755,697 (GRCm39)	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135,710,405 (GRCm39)	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135,756,393 (GRCm39)	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135,709,439 (GRCm39)	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135,900,297 (GRCm39)	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135,756,340 (GRCm39)	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135,710,916 (GRCm39)	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136,021,281 (GRCm39)	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135,709,366 (GRCm39)	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135,713,304 (GRCm39)	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135,710,721 (GRCm39)	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135,900,395 (GRCm39)	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135,710,085 (GRCm39)	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135,717,962 (GRCm39)	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135,713,371 (GRCm39)	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135,710,942 (GRCm39)	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135,900,456 (GRCm39)	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135,749,397 (GRCm39)	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135,710,025 (GRCm39)	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135,757,277 (GRCm39)	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135,717,965 (GRCm39)	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135,710,342 (GRCm39)	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135,717,996 (GRCm39)	missense	probably damaging	1.00
R6647:Grin2b	UTSW	6	135,710,108 (GRCm39)	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135,751,826 (GRCm39)	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135,757,198 (GRCm39)	missense	probably benign
R7033:Grin2b	UTSW	6	135,900,036 (GRCm39)	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135,757,304 (GRCm39)	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135,710,474 (GRCm39)	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135,709,946 (GRCm39)	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135,757,249 (GRCm39)	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135,717,947 (GRCm39)	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135,749,394 (GRCm39)	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135,756,301 (GRCm39)	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135,900,362 (GRCm39)	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135,709,553 (GRCm39)	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135,755,792 (GRCm39)	nonsense	probably null
R8058:Grin2b	UTSW	6	135,710,225 (GRCm39)	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135,710,486 (GRCm39)	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135,709,497 (GRCm39)	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135,900,074 (GRCm39)	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135,899,967 (GRCm39)	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135,710,914 (GRCm39)	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135,709,197 (GRCm39)	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135,899,985 (GRCm39)	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135,749,339 (GRCm39)	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136,021,007 (GRCm39)	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9076:Grin2b	UTSW	6	135,709,509 (GRCm39)	frame shift	probably null
R9172:Grin2b	UTSW	6	135,756,255 (GRCm39)	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135,710,399 (GRCm39)	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135,899,868 (GRCm39)	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136,021,238 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGTAGGATTTGCTGCCGTG -3'
(R):5'- TGTGGCTGTGTCATCCAAC -3'

Sequencing Primer
(F):5'- GTGAAGCAAGCACTGATCATC -3'
(R):5'- GTGTCATCCAACGCCTCCAC -3'

Posted On

2018-06-22