Mutagenetix > Incidental Mutation

Incidental Mutation 'R6616:Grin2b'

524052

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6616 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 135732551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1332 (D1332E)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053880
AA Change: D1332E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: D1332E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111905
AA Change: D1332E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: D1332E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136027

Meta Mutation Damage Score

0.0625

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	T	17: 24,384,535	H567L	probably damaging	Het
Adck1	T	A	12: 88,461,188	M525K	unknown	Het
Alpi	T	C	1: 87,101,114	I74V	possibly damaging	Het
Creb5	A	C	6: 53,685,310	Q197H	possibly damaging	Het
Cyp2b13	A	G	7: 26,085,881	K225R	probably benign	Het
Dock1	G	A	7: 135,108,492	E1143K	possibly damaging	Het
Eef2kmt	T	A	16: 5,247,482	D287V	probably damaging	Het
Eif2ak4	T	A	2: 118,454,845	Y1046*	probably null	Het
Fbxw10	T	A	11: 62,853,024	M252K	probably benign	Het
Fnip2	A	C	3: 79,480,882	H847Q	probably benign	Het
Frmd3	A	T	4: 74,187,488	D457V	probably damaging	Het
Gm13941	T	G	2: 111,101,175	E37D	unknown	Het
Gm8251	C	A	1: 44,061,474	V155L	possibly damaging	Het
Grin1	T	A	2: 25,292,110	I870F	possibly damaging	Het
Gtpbp4	G	A	13: 8,989,105	T201I	possibly damaging	Het
Heatr4	A	G	12: 83,980,130	C118R	probably benign	Het
Hltf	T	A	3: 20,109,487		probably null	Het
Hmcn1	C	T	1: 150,723,257		probably null	Het
Hpd	A	T	5: 123,172,060	L367Q	probably damaging	Het
Htr1b	A	G	9: 81,632,434	I40T	probably benign	Het
Il16	A	G	7: 83,646,476	S464P	probably benign	Het
Lrp1b	T	A	2: 40,699,631	D75V	unknown	Het
Map3k4	A	T	17: 12,271,344	L400Q	probably damaging	Het
Mcts2	T	A	2: 152,687,662	I131N	possibly damaging	Het
Mroh2b	A	C	15: 4,953,282	I1528L	probably benign	Het
Muc4	A	C	16: 32,782,008	D3467A	possibly damaging	Het
Mypn	A	T	10: 63,169,312	C339S	probably damaging	Het
Ncoa5	A	T	2: 165,010,563	Y130*	probably null	Het
Olfr1381	T	A	11: 49,552,041	V98E	probably damaging	Het
Olfr743	T	A	14: 50,533,907	I165N	probably benign	Het
Pcdha4	A	G	18: 36,953,900	T379A	probably benign	Het
Pkp4	C	G	2: 59,350,552	Y720*	probably null	Het
Prl5a1	C	T	13: 28,149,856	T114I	probably benign	Het
Rnd3	A	G	2: 51,134,157	S137P	probably damaging	Het
Rtel1	G	A	2: 181,352,786	E680K	possibly damaging	Het
Sbsn	T	A	7: 30,753,279	V573D	possibly damaging	Het
Scaf8	A	T	17: 3,168,055	L233F	unknown	Het
Sec23a	A	T	12: 58,997,155	I241K	possibly damaging	Het
Secisbp2l	A	T	2: 125,768,226	S258T	probably damaging	Het
Skint4	A	G	4: 112,118,230	H121R	possibly damaging	Het
Sptbn1	T	A	11: 30,124,030	E1346D	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Stpg4	A	G	17: 87,422,696	Y74H	probably damaging	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmc4	A	G	7: 3,671,058	V374A	possibly damaging	Het
Unc45b	G	A	11: 82,911,819	R47Q	probably damaging	Het
Xirp1	A	G	9: 120,019,014	S268P	probably damaging	Het
Zfp990	A	T	4: 145,537,145	I238L	probably benign	Het
Zswim5	A	G	4: 116,986,741	D992G	possibly damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGTAGGATTTGCTGCCGTG -3'
(R):5'- TGTGGCTGTGTCATCCAAC -3'

Sequencing Primer
(F):5'- GTGAAGCAAGCACTGATCATC -3'
(R):5'- GTGTCATCCAACGCCTCCAC -3'

Posted On

2018-06-22