Incidental Mutation 'R6616:Tmc4'
ID524054
Institutional Source Beutler Lab
Gene Symbol Tmc4
Ensembl Gene ENSMUSG00000019734
Gene Nametransmembrane channel-like gene family 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location3665790-3677553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3671058 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 374 (V374A)
Ref Sequence ENSEMBL: ENSMUSP00000043853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038743] [ENSMUST00000121743] [ENSMUST00000145034]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038743
AA Change: V374A

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043853
Gene: ENSMUSG00000019734
AA Change: V374A

DomainStartEndE-ValueType
transmembrane domain 151 173 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 232 251 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 374 396 N/A INTRINSIC
transmembrane domain 409 431 N/A INTRINSIC
Pfam:TMC 457 567 2.5e-42 PFAM
transmembrane domain 572 594 N/A INTRINSIC
transmembrane domain 637 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121743
AA Change: V307A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112541
Gene: ENSMUSG00000019734
AA Change: V307A

DomainStartEndE-ValueType
transmembrane domain 84 106 N/A INTRINSIC
low complexity region 110 124 N/A INTRINSIC
transmembrane domain 165 184 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
Pfam:TMC 390 500 1.4e-40 PFAM
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 570 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144751
Predicted Effect probably benign
Transcript: ENSMUST00000145034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148313
Meta Mutation Damage Score 0.1115 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Tmc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Tmc4 APN 7 3675518 missense possibly damaging 0.85
IGL01661:Tmc4 APN 7 3666927 missense probably damaging 0.97
IGL02163:Tmc4 APN 7 3666825 missense probably damaging 0.98
IGL03149:Tmc4 APN 7 3667178 missense probably benign 0.00
R0233:Tmc4 UTSW 7 3666867 missense probably benign
R0233:Tmc4 UTSW 7 3666867 missense probably benign
R0483:Tmc4 UTSW 7 3667610 missense probably damaging 0.98
R2406:Tmc4 UTSW 7 3671026 missense probably benign 0.00
R3834:Tmc4 UTSW 7 3672007 missense probably benign 0.00
R3897:Tmc4 UTSW 7 3671088 missense probably benign 0.43
R4434:Tmc4 UTSW 7 3672007 missense probably benign 0.00
R4664:Tmc4 UTSW 7 3671271 splice site probably null
R4666:Tmc4 UTSW 7 3671271 splice site probably null
R5764:Tmc4 UTSW 7 3672023 missense probably damaging 0.98
R5914:Tmc4 UTSW 7 3672009 missense probably benign 0.03
R6077:Tmc4 UTSW 7 3667527 missense probably damaging 1.00
R6090:Tmc4 UTSW 7 3671053 missense probably damaging 1.00
R6332:Tmc4 UTSW 7 3677422 critical splice donor site probably null
R6362:Tmc4 UTSW 7 3675459 missense probably benign 0.00
R7317:Tmc4 UTSW 7 3669919 missense probably benign 0.18
R7696:Tmc4 UTSW 7 3669575 missense probably damaging 0.98
R8291:Tmc4 UTSW 7 3671422 missense probably benign
X0022:Tmc4 UTSW 7 3671041 missense possibly damaging 0.92
X0028:Tmc4 UTSW 7 3675016 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGGGATTAAAGGCGTGC -3'
(R):5'- CACATTTCCACAGGTGAAGAAG -3'

Sequencing Primer
(F):5'- ATTTGTAGAACCTTTTTCCACCTG -3'
(R):5'- TTTCCACAGGTGAAGAAGCCCTG -3'
Posted On2018-06-22