Incidental Mutation 'R6616:Cyp2b13'
ID524055
Institutional Source Beutler Lab
Gene Symbol Cyp2b13
Ensembl Gene ENSMUSG00000040583
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 13
Synonymsphenobarbital inducible, type c
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26061497-26096197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26085881 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 225 (K225R)
Ref Sequence ENSEMBL: ENSMUSP00000005669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005669]
Predicted Effect probably benign
Transcript: ENSMUST00000005669
AA Change: K225R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005669
Gene: ENSMUSG00000040583
AA Change: K225R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 9.8e-150 PFAM
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Cyp2b13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Cyp2b13 APN 7 26081727 missense probably benign 0.26
IGL01134:Cyp2b13 APN 7 26081700 missense probably damaging 1.00
IGL02386:Cyp2b13 APN 7 26086013 missense probably damaging 1.00
IGL02531:Cyp2b13 APN 7 26061605 missense possibly damaging 0.55
IGL02960:Cyp2b13 APN 7 26061676 missense probably benign 0.33
R0018:Cyp2b13 UTSW 7 26085950 missense probably benign 0.30
R0018:Cyp2b13 UTSW 7 26085950 missense probably benign 0.30
R0103:Cyp2b13 UTSW 7 26088710 missense probably damaging 1.00
R0121:Cyp2b13 UTSW 7 26086585 missense probably benign
R0392:Cyp2b13 UTSW 7 26085883 missense probably benign 0.01
R0540:Cyp2b13 UTSW 7 26081711 missense probably benign 0.07
R1887:Cyp2b13 UTSW 7 26088650 missense probably damaging 1.00
R2416:Cyp2b13 UTSW 7 26095821 makesense probably null
R2879:Cyp2b13 UTSW 7 26086031 critical splice donor site probably null
R4654:Cyp2b13 UTSW 7 26061647 missense probably damaging 1.00
R4735:Cyp2b13 UTSW 7 26088295 missense probably benign
R4969:Cyp2b13 UTSW 7 26080988 missense probably damaging 0.98
R5174:Cyp2b13 UTSW 7 26088693 missense possibly damaging 0.68
R6243:Cyp2b13 UTSW 7 26061619 missense probably damaging 1.00
R6647:Cyp2b13 UTSW 7 26085899 missense possibly damaging 0.52
R6766:Cyp2b13 UTSW 7 26081811 critical splice donor site probably null
R6844:Cyp2b13 UTSW 7 26081697 missense probably damaging 1.00
R7431:Cyp2b13 UTSW 7 26061551 missense probably damaging 0.96
R7593:Cyp2b13 UTSW 7 26080991 missense possibly damaging 0.64
R7719:Cyp2b13 UTSW 7 26095670 missense probably damaging 1.00
R7857:Cyp2b13 UTSW 7 26088728 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTGCTTAAGAAATGGGAGTCC -3'
(R):5'- GCCTCTCTCATCCATGCAGG -3'

Sequencing Primer
(F):5'- CCATGTAAGGCCCAGTGTTC -3'
(R):5'- GGATTAACCTTCTCCATCCTCAGCAG -3'
Posted On2018-06-22