Incidental Mutation 'R6580:1700007K13Rik'
ID524056
Institutional Source Beutler Lab
Gene Symbol 1700007K13Rik
Ensembl Gene ENSMUSG00000026831
Gene NameRIKEN cDNA 1700007K13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6580 (G1)
Quality Score224.009
Status Validated
Chromosome2
Chromosomal Location28462001-28466332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28466050 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 74 (W74R)
Ref Sequence ENSEMBL: ENSMUSP00000116111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038600] [ENSMUST00000086370] [ENSMUST00000127683]
Predicted Effect probably benign
Transcript: ENSMUST00000038600
SMART Domains Protein: ENSMUSP00000036725
Gene: ENSMUSG00000035772

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 81 182 4.6e-23 PFAM
Pfam:Ribosomal_S2 180 257 7.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086370
AA Change: W74R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083557
Gene: ENSMUSG00000026831
AA Change: W74R

DomainStartEndE-ValueType
Pfam:DUF4490 35 137 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126242
Predicted Effect probably damaging
Transcript: ENSMUST00000127683
AA Change: W74R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116111
Gene: ENSMUSG00000026831
AA Change: W74R

DomainStartEndE-ValueType
Pfam:DUF4490 33 122 1.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146332
Meta Mutation Damage Score 0.3964 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe laterality defects, including situs inversus totalis and heterotaxy with randomized situs and left and right isomerisms. Homozygous embryos with isomerisms die in utero due to associated cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,625 R525H probably benign Het
Acox3 T A 5: 35,608,403 L600Q probably damaging Het
Ankrd49 A G 9: 14,781,398 S157P probably damaging Het
Ccdc141 A G 2: 77,011,755 F1444S possibly damaging Het
Defb28 C T 2: 152,518,295 S10L possibly damaging Het
Epha6 T G 16: 59,682,616 N976T probably damaging Het
Gm45861 A G 8: 27,544,951 K976E unknown Het
Gtf2ird1 T G 5: 134,361,039 N920H probably damaging Het
Gtf3c1 A T 7: 125,644,347 M1695K probably benign Het
Hfm1 C T 5: 106,847,709 E1279K probably benign Het
Il31ra C T 13: 112,551,942 D34N possibly damaging Het
Klhl3 T A 13: 58,018,887 I430F possibly damaging Het
Lexm G T 4: 106,611,514 H271N possibly damaging Het
Mfhas1 A G 8: 35,589,265 Y298C probably damaging Het
Muc20 A T 16: 32,793,489 M506K possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Naip1 T A 13: 100,444,649 D30V probably damaging Het
Nol9 A G 4: 152,051,761 N430S probably benign Het
Olfr907 T C 9: 38,499,023 M118T probably damaging Het
Palm3 A G 8: 84,029,548 E563G probably damaging Het
Pcdhga4 A G 18: 37,687,317 S640G possibly damaging Het
Pi4ka A G 16: 17,350,830 F679L probably damaging Het
Polr3c A G 3: 96,727,343 probably null Het
Ptdss2 T A 7: 141,153,012 I236N probably damaging Het
Rapgef1 A G 2: 29,730,609 Y879C possibly damaging Het
Shc3 T C 13: 51,442,773 T405A probably benign Het
Smtnl2 G T 11: 72,403,033 S232R probably benign Het
Taar8a G A 10: 24,076,893 A132T probably damaging Het
Tex47 T C 5: 7,305,212 I131T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r63 A G 7: 5,802,914 S240P probably benign Het
Vmn2r84 A G 10: 130,389,241 W467R possibly damaging Het
Vmn2r-ps130 T C 17: 23,063,766 V140A probably benign Het
Zscan12 T C 13: 21,369,158 L384P probably damaging Het
Other mutations in 1700007K13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:1700007K13Rik APN 2 28465180 missense probably damaging 0.97
R0423:1700007K13Rik UTSW 2 28466024 splice site probably benign
R0604:1700007K13Rik UTSW 2 28466091 missense possibly damaging 0.55
R6819:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7292:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7351:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7441:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7569:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7620:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7802:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7898:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7959:1700007K13Rik UTSW 2 28462357 missense probably damaging 1.00
R8300:1700007K13Rik UTSW 2 28462423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTGTGGTTGCTCAGACAG -3'
(R):5'- GATCTGGGCTAGTTTCCTGC -3'

Sequencing Primer
(F):5'- GCAGGACCCTAACAGTAATGATGAC -3'
(R):5'- TGCGGGAGGCCAAATGTC -3'
Posted On2018-06-22