Incidental Mutation 'R6580:Rapgef1'
ID524058
Institutional Source Beutler Lab
Gene Symbol Rapgef1
Ensembl Gene ENSMUSG00000039844
Gene NameRap guanine nucleotide exchange factor (GEF) 1
SynonymsGrf2, 4932418O06Rik, C3G
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6580 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location29619720-29740978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29730609 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 879 (Y879C)
Ref Sequence ENSEMBL: ENSMUSP00000088680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091146] [ENSMUST00000095087] [ENSMUST00000102872] [ENSMUST00000147755]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091146
AA Change: Y879C

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088680
Gene: ENSMUSG00000039844
AA Change: Y879C

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 664 682 N/A INTRINSIC
low complexity region 689 700 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
RasGEFN 828 970 8.04e-37 SMART
RasGEF 977 1206 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095087
AA Change: Y885C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092703
Gene: ENSMUSG00000039844
AA Change: Y885C

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 702 720 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
RasGEFN 834 976 8.04e-37 SMART
RasGEF 983 1212 5.85e-102 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102872
AA Change: Y747C

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099936
Gene: ENSMUSG00000039844
AA Change: Y747C

DomainStartEndE-ValueType
low complexity region 229 244 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
low complexity region 506 516 N/A INTRINSIC
low complexity region 548 559 N/A INTRINSIC
RasGEFN 696 838 8.04e-37 SMART
RasGEF 845 1074 5.85e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137719
Predicted Effect unknown
Transcript: ENSMUST00000147488
AA Change: Y303C
SMART Domains Protein: ENSMUSP00000117631
Gene: ENSMUSG00000039844
AA Change: Y303C

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
RasGEFN 253 395 8.04e-37 SMART
RasGEF 402 631 5.85e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147755
SMART Domains Protein: ENSMUSP00000121615
Gene: ENSMUSG00000039844

DomainStartEndE-ValueType
low complexity region 191 206 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 468 478 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
low complexity region 663 681 N/A INTRINSIC
Meta Mutation Damage Score 0.1422 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die before E7.5. Mice homozygous for a hypomorphic gene trap allele show embryonic lethality during organogenesis, altered neuroepithelium morphology, vascular maturation defects, hemorrhage, and reduced cell migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,625 R525H probably benign Het
1700007K13Rik A G 2: 28,466,050 W74R probably damaging Het
Acox3 T A 5: 35,608,403 L600Q probably damaging Het
Ankrd49 A G 9: 14,781,398 S157P probably damaging Het
Ccdc141 A G 2: 77,011,755 F1444S possibly damaging Het
Defb28 C T 2: 152,518,295 S10L possibly damaging Het
Epha6 T G 16: 59,682,616 N976T probably damaging Het
Gm45861 A G 8: 27,544,951 K976E unknown Het
Gtf2ird1 T G 5: 134,361,039 N920H probably damaging Het
Gtf3c1 A T 7: 125,644,347 M1695K probably benign Het
Hfm1 C T 5: 106,847,709 E1279K probably benign Het
Il31ra C T 13: 112,551,942 D34N possibly damaging Het
Klhl3 T A 13: 58,018,887 I430F possibly damaging Het
Lexm G T 4: 106,611,514 H271N possibly damaging Het
Mfhas1 A G 8: 35,589,265 Y298C probably damaging Het
Muc20 A T 16: 32,793,489 M506K possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Naip1 T A 13: 100,444,649 D30V probably damaging Het
Nol9 A G 4: 152,051,761 N430S probably benign Het
Olfr907 T C 9: 38,499,023 M118T probably damaging Het
Palm3 A G 8: 84,029,548 E563G probably damaging Het
Pcdhga4 A G 18: 37,687,317 S640G possibly damaging Het
Pi4ka A G 16: 17,350,830 F679L probably damaging Het
Polr3c A G 3: 96,727,343 probably null Het
Ptdss2 T A 7: 141,153,012 I236N probably damaging Het
Shc3 T C 13: 51,442,773 T405A probably benign Het
Smtnl2 G T 11: 72,403,033 S232R probably benign Het
Taar8a G A 10: 24,076,893 A132T probably damaging Het
Tex47 T C 5: 7,305,212 I131T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r63 A G 7: 5,802,914 S240P probably benign Het
Vmn2r84 A G 10: 130,389,241 W467R possibly damaging Het
Vmn2r-ps130 T C 17: 23,063,766 V140A probably benign Het
Zscan12 T C 13: 21,369,158 L384P probably damaging Het
Other mutations in Rapgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Rapgef1 APN 2 29722269 missense probably benign
IGL00917:Rapgef1 APN 2 29702523 missense probably benign 0.00
IGL02618:Rapgef1 APN 2 29737943 missense probably damaging 1.00
IGL02642:Rapgef1 APN 2 29700860 splice site probably benign
IGL02974:Rapgef1 APN 2 29710216 missense possibly damaging 0.64
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0034:Rapgef1 UTSW 2 29724768 splice site probably benign
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0241:Rapgef1 UTSW 2 29702670 missense possibly damaging 0.53
R0279:Rapgef1 UTSW 2 29726227 missense probably damaging 1.00
R0432:Rapgef1 UTSW 2 29679816 missense possibly damaging 0.86
R1817:Rapgef1 UTSW 2 29686256 missense probably damaging 1.00
R1837:Rapgef1 UTSW 2 29737426 missense probably damaging 1.00
R1970:Rapgef1 UTSW 2 29733711 missense probably damaging 1.00
R1980:Rapgef1 UTSW 2 29722227 missense probably benign
R2076:Rapgef1 UTSW 2 29702508 missense probably benign 0.00
R2363:Rapgef1 UTSW 2 29736596 missense possibly damaging 0.63
R3016:Rapgef1 UTSW 2 29707393 missense probably damaging 1.00
R3053:Rapgef1 UTSW 2 29724856 missense probably damaging 1.00
R3777:Rapgef1 UTSW 2 29719689 missense possibly damaging 0.67
R3980:Rapgef1 UTSW 2 29719650 missense probably benign 0.33
R4491:Rapgef1 UTSW 2 29719656 missense possibly damaging 0.93
R4524:Rapgef1 UTSW 2 29679246 missense probably benign 0.00
R4732:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R4733:Rapgef1 UTSW 2 29689160 missense probably damaging 1.00
R5391:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5395:Rapgef1 UTSW 2 29737965 missense probably damaging 1.00
R5611:Rapgef1 UTSW 2 29702436 missense probably damaging 0.96
R6062:Rapgef1 UTSW 2 29700732 missense probably damaging 0.96
R6145:Rapgef1 UTSW 2 29736666 missense probably damaging 1.00
R6892:Rapgef1 UTSW 2 29699840 critical splice donor site probably null
R6897:Rapgef1 UTSW 2 29702502 missense probably damaging 1.00
R6957:Rapgef1 UTSW 2 29733698 missense possibly damaging 0.62
R7039:Rapgef1 UTSW 2 29726214 missense probably damaging 0.97
R7149:Rapgef1 UTSW 2 29720700 missense probably damaging 0.98
R7253:Rapgef1 UTSW 2 29699721 missense possibly damaging 0.72
R7315:Rapgef1 UTSW 2 29734492 missense probably damaging 0.98
R7956:Rapgef1 UTSW 2 29699015 missense probably benign 0.03
R8161:Rapgef1 UTSW 2 29679198 missense probably benign 0.08
R8162:Rapgef1 UTSW 2 29735999 missense probably damaging 0.99
R8372:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
R8373:Rapgef1 UTSW 2 29710231 missense probably damaging 0.99
RF005:Rapgef1 UTSW 2 29707195 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCAGAAGTAGCCAGTGCCC -3'
(R):5'- AAGTGCTATCCTGGGTCTTTAG -3'

Sequencing Primer
(F):5'- ACCTACCTGGCTTTTAGAGAGGAC -3'
(R):5'- ATCCTGGGTCTTTAGGGCCC -3'
Posted On2018-06-22