Incidental Mutation 'R6616:Dock1'
ID524063
Institutional Source Beutler Lab
Gene Symbol Dock1
Ensembl Gene ENSMUSG00000058325
Gene Namededicator of cytokinesis 1
SynonymsD630004B07Rik, Dock180, 9130006G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location134670654-135173639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135108492 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1143 (E1143K)
Ref Sequence ENSEMBL: ENSMUSP00000081531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488]
PDB Structure
Solution structure of the SH3 domain of DOCK180 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084488
AA Change: E1143K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325
AA Change: E1143K

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Meta Mutation Damage Score 0.3239 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Dock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Dock1 APN 7 135146531 splice site probably benign
IGL01319:Dock1 APN 7 134789278 missense probably benign
IGL01390:Dock1 APN 7 134745047 missense possibly damaging 0.95
IGL01394:Dock1 APN 7 134766216 missense probably benign 0.01
IGL01489:Dock1 APN 7 134999321 splice site probably benign
IGL01505:Dock1 APN 7 135158510 missense possibly damaging 0.91
IGL01586:Dock1 APN 7 134753377 missense probably damaging 1.00
IGL01637:Dock1 APN 7 135137813 critical splice acceptor site probably null
IGL01649:Dock1 APN 7 134777410 missense probably damaging 1.00
IGL01652:Dock1 APN 7 134777497 splice site probably benign
IGL01859:Dock1 APN 7 135077161 missense possibly damaging 0.51
IGL02068:Dock1 APN 7 134771548 missense probably benign 0.26
IGL02168:Dock1 APN 7 135077131 splice site probably benign
IGL02200:Dock1 APN 7 134744271 missense probably benign 0.01
IGL02244:Dock1 APN 7 134777445 nonsense probably null
IGL02285:Dock1 APN 7 135081920 critical splice donor site probably null
IGL02319:Dock1 APN 7 134772449 missense possibly damaging 0.94
IGL02334:Dock1 APN 7 135145565 missense probably damaging 1.00
IGL02338:Dock1 APN 7 135133075 missense possibly damaging 0.95
IGL02351:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02358:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02607:Dock1 APN 7 134851513 missense probably benign 0.13
IGL02638:Dock1 APN 7 135146480 missense probably benign 0.09
IGL02724:Dock1 APN 7 135163353 missense probably benign
IGL02820:Dock1 APN 7 135167215 missense probably benign 0.11
IGL02950:Dock1 APN 7 134730024 missense probably damaging 1.00
IGL02993:Dock1 APN 7 134744298 missense probably benign
IGL03000:Dock1 APN 7 134789240 missense probably benign 0.17
IGL03092:Dock1 APN 7 134765216 splice site probably benign
IGL03131:Dock1 APN 7 134874183 missense possibly damaging 0.80
IGL03136:Dock1 APN 7 135168389 missense probably benign 0.00
IGL03210:Dock1 APN 7 134756939 missense possibly damaging 0.62
IGL03220:Dock1 APN 7 135108522 critical splice donor site probably null
P0028:Dock1 UTSW 7 134999324 splice site probably benign
PIT4453001:Dock1 UTSW 7 135152300 missense probably benign
R0003:Dock1 UTSW 7 134730064 splice site probably benign
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0179:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0180:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0347:Dock1 UTSW 7 134763867 missense probably damaging 1.00
R0399:Dock1 UTSW 7 135163442 missense probably benign 0.00
R0457:Dock1 UTSW 7 135138145 missense possibly damaging 0.90
R0480:Dock1 UTSW 7 134737718 missense probably damaging 1.00
R0521:Dock1 UTSW 7 135143778 missense probably benign 0.21
R0792:Dock1 UTSW 7 134874150 missense probably benign 0.02
R1136:Dock1 UTSW 7 134848173 missense possibly damaging 0.95
R1224:Dock1 UTSW 7 135108819 missense possibly damaging 0.67
R1267:Dock1 UTSW 7 134746436 missense probably damaging 1.00
R1373:Dock1 UTSW 7 135167175 missense probably benign 0.01
R1401:Dock1 UTSW 7 135133936 nonsense probably null
R1454:Dock1 UTSW 7 134851609 splice site probably benign
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1523:Dock1 UTSW 7 134744247 missense possibly damaging 0.49
R1643:Dock1 UTSW 7 135098779 missense probably damaging 1.00
R1659:Dock1 UTSW 7 134789243 missense probably damaging 0.98
R1793:Dock1 UTSW 7 135098727 splice site probably null
R1864:Dock1 UTSW 7 135146507 missense probably benign 0.07
R1911:Dock1 UTSW 7 134999300 missense probably damaging 1.00
R2567:Dock1 UTSW 7 135145484 missense probably damaging 1.00
R3816:Dock1 UTSW 7 134744286 nonsense probably null
R3971:Dock1 UTSW 7 134746908 missense probably damaging 1.00
R4063:Dock1 UTSW 7 135115292 missense possibly damaging 0.81
R4163:Dock1 UTSW 7 134744322 missense possibly damaging 0.79
R4271:Dock1 UTSW 7 134734054 missense probably damaging 0.99
R4684:Dock1 UTSW 7 134724409 nonsense probably null
R4717:Dock1 UTSW 7 134848170 missense probably damaging 1.00
R4725:Dock1 UTSW 7 134745014 nonsense probably null
R4788:Dock1 UTSW 7 135145484 missense probably damaging 0.98
R4869:Dock1 UTSW 7 134734071 missense probably damaging 1.00
R4889:Dock1 UTSW 7 134744976 missense probably benign 0.02
R4953:Dock1 UTSW 7 135152288 missense probably benign 0.34
R5031:Dock1 UTSW 7 135152246 missense probably benign 0.02
R5161:Dock1 UTSW 7 134734062 missense possibly damaging 0.69
R5168:Dock1 UTSW 7 135118908 missense probably damaging 1.00
R5212:Dock1 UTSW 7 134789194 missense possibly damaging 0.68
R5648:Dock1 UTSW 7 134746954 missense probably damaging 1.00
R5685:Dock1 UTSW 7 134772362 missense probably benign 0.19
R5834:Dock1 UTSW 7 134763933 missense probably damaging 1.00
R6181:Dock1 UTSW 7 135158522 missense probably damaging 1.00
R6334:Dock1 UTSW 7 134851576 missense probably benign 0.01
R6406:Dock1 UTSW 7 135145486 missense probably benign 0.26
R6425:Dock1 UTSW 7 135163381 missense possibly damaging 0.79
R6489:Dock1 UTSW 7 134990541 missense probably damaging 0.99
R6706:Dock1 UTSW 7 135133886 missense possibly damaging 0.72
R6766:Dock1 UTSW 7 134756793 splice site probably null
R6861:Dock1 UTSW 7 134771478 missense probably benign 0.00
R6985:Dock1 UTSW 7 135163403 missense possibly damaging 0.95
R7259:Dock1 UTSW 7 134782748 missense probably damaging 0.99
R7285:Dock1 UTSW 7 134745008 missense probably benign 0.01
R7471:Dock1 UTSW 7 135163343 missense possibly damaging 0.65
R7497:Dock1 UTSW 7 134765274 missense probably benign
R7691:Dock1 UTSW 7 135138157 critical splice donor site probably null
R7732:Dock1 UTSW 7 134744970 missense probably benign 0.01
R7818:Dock1 UTSW 7 134763865 missense probably damaging 1.00
R7918:Dock1 UTSW 7 135145418 missense probably damaging 1.00
R7960:Dock1 UTSW 7 135077188 missense possibly damaging 0.83
R7961:Dock1 UTSW 7 134745057 missense possibly damaging 0.77
R7985:Dock1 UTSW 7 134746954 missense possibly damaging 0.95
R8009:Dock1 UTSW 7 134745057 missense possibly damaging 0.77
R8060:Dock1 UTSW 7 135168403 missense probably benign
R8060:Dock1 UTSW 7 134990629 splice site probably benign
R8061:Dock1 UTSW 7 134772323 missense probably benign 0.00
R8101:Dock1 UTSW 7 134999288 missense possibly damaging 0.89
X0062:Dock1 UTSW 7 135108451 missense probably damaging 1.00
Z1088:Dock1 UTSW 7 134804547 missense probably damaging 0.98
Z1177:Dock1 UTSW 7 134782400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTCTGTAAGGGCTCAGGG -3'
(R):5'- CTCCAAGAAAGAAACTTGAGGC -3'

Sequencing Primer
(F):5'- GGACAGCATCTCTGAAATGAAATC -3'
(R):5'- TGAGGCATGGTTTAAAATATTTCCC -3'
Posted On2018-06-22