Incidental Mutation 'R6616:Htr1b'
ID524065
Institutional Source Beutler Lab
Gene Symbol Htr1b
Ensembl Gene ENSMUSG00000049511
Gene Name5-hydroxytryptamine (serotonin) receptor 1B
Synonyms5-HT1B receptor, 5-HT<1B> receptor, 5HT1B receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6616 (G1)
Quality Score186.009
Status Validated
Chromosome9
Chromosomal Location81628291-81633828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81632434 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 40 (I40T)
Ref Sequence ENSEMBL: ENSMUSP00000139389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051005] [ENSMUST00000183482]
Predicted Effect probably benign
Transcript: ENSMUST00000051005
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050898
Gene: ENSMUSG00000049511
AA Change: I40T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 6e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1.8e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181893
Predicted Effect probably benign
Transcript: ENSMUST00000183482
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139389
Gene: ENSMUSG00000049511
AA Change: I40T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 53 188 5.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 380 7.5e-12 PFAM
Pfam:7tm_1 62 365 1e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183781
Meta Mutation Damage Score 0.0880 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is a G-protein coupled receptor for serotonin (5-hydroxytryptamine). Ligand binding activates second messengers that inhibit the activity of adenylate cyclase and manage the release of serotonin, dopamine, and acetylcholine in the brain. The encoded protein may be involved in several neuropsychiatric disorders and therefore is often a target of antidepressant and other psychotherapeutic drugs. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit an increase in body weight, aggression, drinking behavior, and osteoblast proliferation and bone mass, and show altered spatial learning and operant conditional behavior as well as reduced anxiety-related response and startle reflex, and small testes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Htr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02932:Htr1b APN 9 81631636 missense probably damaging 1.00
IGL03144:Htr1b APN 9 81631945 missense probably damaging 0.96
IGL03350:Htr1b APN 9 81632122 missense probably damaging 1.00
R0395:Htr1b UTSW 9 81631651 missense probably benign 0.09
R0697:Htr1b UTSW 9 81631463 missense possibly damaging 0.77
R1569:Htr1b UTSW 9 81632287 missense probably benign 0.01
R3411:Htr1b UTSW 9 81632041 missense probably benign 0.00
R3821:Htr1b UTSW 9 81632434 missense probably benign 0.02
R4359:Htr1b UTSW 9 81632351 missense probably benign 0.12
R4487:Htr1b UTSW 9 81631539 missense probably benign 0.01
R4489:Htr1b UTSW 9 81631539 missense probably benign 0.01
R4715:Htr1b UTSW 9 81631510 missense possibly damaging 0.95
R5502:Htr1b UTSW 9 81631801 missense possibly damaging 0.82
R6393:Htr1b UTSW 9 81631757 missense probably benign 0.11
R6900:Htr1b UTSW 9 81631570 missense probably damaging 1.00
R7038:Htr1b UTSW 9 81632243 missense probably benign
R7850:Htr1b UTSW 9 81632599 utr 5 prime probably null
R7954:Htr1b UTSW 9 81631945 missense probably damaging 0.96
R8074:Htr1b UTSW 9 81631529 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATGGTGCTGATGGGCATC -3'
(R):5'- CAAGCCTATAGTCTCCATGATCC -3'

Sequencing Primer
(F):5'- TGCTGATGGGCATCACCAG -3'
(R):5'- ATAGTCTCCATGATCCTCCCG -3'
Posted On2018-06-22