Incidental Mutation 'R6580:Nol9'
ID524068
Institutional Source Beutler Lab
Gene Symbol Nol9
Ensembl Gene ENSMUSG00000028948
Gene Namenucleolar protein 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6580 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location152039321-152061494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152051761 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 430 (N430S)
Ref Sequence ENSEMBL: ENSMUSP00000099486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084116] [ENSMUST00000103197]
Predicted Effect probably benign
Transcript: ENSMUST00000084116
AA Change: N430S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081133
Gene: ENSMUSG00000028948
AA Change: N430S

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
low complexity region 79 106 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
Pfam:CLP1_P 322 480 7.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103197
AA Change: N430S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099486
Gene: ENSMUSG00000028948
AA Change: N430S

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
low complexity region 79 106 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
Pfam:MobB 316 429 5.9e-18 PFAM
Pfam:Clp1 425 665 1.9e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105663
SMART Domains Protein: ENSMUSP00000101288
Gene: ENSMUSG00000028948

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
low complexity region 79 106 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
Pfam:MobB 316 429 5.3e-18 PFAM
Pfam:Clp1 425 627 5.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147797
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,625 R525H probably benign Het
1700007K13Rik A G 2: 28,466,050 W74R probably damaging Het
Acox3 T A 5: 35,608,403 L600Q probably damaging Het
Ankrd49 A G 9: 14,781,398 S157P probably damaging Het
Ccdc141 A G 2: 77,011,755 F1444S possibly damaging Het
Defb28 C T 2: 152,518,295 S10L possibly damaging Het
Epha6 T G 16: 59,682,616 N976T probably damaging Het
Gm45861 A G 8: 27,544,951 K976E unknown Het
Gtf2ird1 T G 5: 134,361,039 N920H probably damaging Het
Gtf3c1 A T 7: 125,644,347 M1695K probably benign Het
Hfm1 C T 5: 106,847,709 E1279K probably benign Het
Il31ra C T 13: 112,551,942 D34N possibly damaging Het
Klhl3 T A 13: 58,018,887 I430F possibly damaging Het
Lexm G T 4: 106,611,514 H271N possibly damaging Het
Mfhas1 A G 8: 35,589,265 Y298C probably damaging Het
Muc20 A T 16: 32,793,489 M506K possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Naip1 T A 13: 100,444,649 D30V probably damaging Het
Olfr907 T C 9: 38,499,023 M118T probably damaging Het
Palm3 A G 8: 84,029,548 E563G probably damaging Het
Pcdhga4 A G 18: 37,687,317 S640G possibly damaging Het
Pi4ka A G 16: 17,350,830 F679L probably damaging Het
Polr3c A G 3: 96,727,343 probably null Het
Ptdss2 T A 7: 141,153,012 I236N probably damaging Het
Rapgef1 A G 2: 29,730,609 Y879C possibly damaging Het
Shc3 T C 13: 51,442,773 T405A probably benign Het
Smtnl2 G T 11: 72,403,033 S232R probably benign Het
Taar8a G A 10: 24,076,893 A132T probably damaging Het
Tex47 T C 5: 7,305,212 I131T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r63 A G 7: 5,802,914 S240P probably benign Het
Vmn2r84 A G 10: 130,389,241 W467R possibly damaging Het
Vmn2r-ps130 T C 17: 23,063,766 V140A probably benign Het
Zscan12 T C 13: 21,369,158 L384P probably damaging Het
Other mutations in Nol9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Nol9 APN 4 152052015 missense probably benign 0.38
IGL00774:Nol9 APN 4 152052015 missense probably benign 0.38
IGL00885:Nol9 APN 4 152041600 missense probably damaging 1.00
IGL01125:Nol9 APN 4 152046609 missense probably damaging 1.00
IGL01368:Nol9 APN 4 152058391 missense probably benign
IGL01759:Nol9 APN 4 152046043 intron probably benign
IGL01983:Nol9 APN 4 152046037 critical splice donor site probably null
IGL02185:Nol9 APN 4 152057911 missense probably damaging 1.00
IGL02869:Nol9 APN 4 152046573 missense probably damaging 1.00
IGL02967:Nol9 APN 4 152041102 missense possibly damaging 0.95
R0401:Nol9 UTSW 4 152052605 missense probably benign 0.00
R3721:Nol9 UTSW 4 152039706 missense probably benign 0.07
R4429:Nol9 UTSW 4 152041174 missense probably damaging 1.00
R4460:Nol9 UTSW 4 152057836 missense probably damaging 1.00
R4837:Nol9 UTSW 4 152052095 intron probably benign
R5137:Nol9 UTSW 4 152045971 missense probably damaging 1.00
R5698:Nol9 UTSW 4 152050574 missense probably damaging 0.98
R6190:Nol9 UTSW 4 152041234 missense possibly damaging 0.85
R6317:Nol9 UTSW 4 152041057 missense probably damaging 1.00
R6372:Nol9 UTSW 4 152045995 missense probably damaging 1.00
R6525:Nol9 UTSW 4 152039449 missense probably damaging 0.98
R6551:Nol9 UTSW 4 152051868 missense possibly damaging 0.80
R7538:Nol9 UTSW 4 152039658 missense probably benign 0.05
R8143:Nol9 UTSW 4 152041102 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACACTGCCTGGCTCTTGTTG -3'
(R):5'- AAGACTGGAAGTGGACTAGACTCTTTC -3'

Sequencing Primer
(F):5'- TGTCAGCTGTGCATATGC -3'
(R):5'- GGAAGTGGACTAGACTCTTTCTCTTC -3'
Posted On2018-06-22