Incidental Mutation 'R6616:Sptbn1'
ID524071
Institutional Source Beutler Lab
Gene Symbol Sptbn1
Ensembl Gene ENSMUSG00000020315
Gene Namespectrin beta, non-erythrocytic 1
Synonymsnon-erythrocytic, Spnb-2, elf3, 9930031C03Rik, elf1, beta fodrin, brain spectrin, spectrin G, Spnb2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location30099395-30268175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30124030 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1346 (E1346D)
Ref Sequence ENSEMBL: ENSMUSP00000114841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]
Predicted Effect probably benign
Transcript: ENSMUST00000006629
AA Change: E1346D

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: E1346D

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011877
AA Change: E1346D

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: E1346D

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2162 3.1e-10 SMART
PH 2197 2308 1.64e-18 SMART
low complexity region 2312 2327 N/A INTRINSIC
low complexity region 2343 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102838
AA Change: E1333D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: E1333D

DomainStartEndE-ValueType
CH 43 143 3.02e-28 SMART
CH 162 260 8.73e-25 SMART
SPEC 292 398 2.03e0 SMART
SPEC 412 512 6.42e-26 SMART
SPEC 518 622 4.61e-27 SMART
SPEC 628 728 2.36e-33 SMART
SPEC 734 833 1.2e-25 SMART
SPEC 839 939 7.16e-24 SMART
SPEC 945 1046 6.58e-23 SMART
SPEC 1052 1153 1.79e-24 SMART
SPEC 1159 1259 2.2e-24 SMART
SPEC 1265 1364 5.18e-21 SMART
SPEC 1370 1469 1.02e-19 SMART
SPEC 1475 1576 7.2e-29 SMART
SPEC 1582 1682 8.03e-27 SMART
SPEC 1688 1789 9.73e-26 SMART
SPEC 1795 1895 9.82e-22 SMART
SPEC 1901 2001 8.68e-23 SMART
SPEC 2007 2114 2.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124231
AA Change: E1346D

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: E1346D

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
CH 56 156 3.02e-28 SMART
CH 175 273 8.73e-25 SMART
SPEC 305 411 2.03e0 SMART
SPEC 425 525 6.42e-26 SMART
SPEC 531 635 4.61e-27 SMART
SPEC 641 741 2.36e-33 SMART
SPEC 747 846 1.2e-25 SMART
SPEC 852 952 7.16e-24 SMART
SPEC 958 1059 6.58e-23 SMART
SPEC 1065 1166 1.79e-24 SMART
SPEC 1172 1272 2.2e-24 SMART
SPEC 1278 1377 5.18e-21 SMART
SPEC 1383 1482 1.02e-19 SMART
SPEC 1488 1589 7.2e-29 SMART
SPEC 1595 1695 8.03e-27 SMART
SPEC 1701 1802 9.73e-26 SMART
SPEC 1808 1908 9.82e-22 SMART
SPEC 1914 2014 8.68e-23 SMART
SPEC 2020 2092 6.42e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Sptbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sptbn1 APN 11 30110818 nonsense probably null
IGL01098:Sptbn1 APN 11 30159385 missense probably damaging 1.00
IGL01843:Sptbn1 APN 11 30104623 missense probably benign 0.02
IGL02070:Sptbn1 APN 11 30145979 missense probably damaging 0.99
IGL02075:Sptbn1 APN 11 30138496 missense probably damaging 1.00
IGL02094:Sptbn1 APN 11 30100659 missense probably benign 0.01
IGL02102:Sptbn1 APN 11 30137427 missense probably damaging 1.00
IGL02189:Sptbn1 APN 11 30117871 missense probably damaging 1.00
IGL02256:Sptbn1 APN 11 30120990 missense probably benign 0.24
IGL02301:Sptbn1 APN 11 30142129 missense probably damaging 1.00
IGL02354:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02361:Sptbn1 APN 11 30110783 missense probably damaging 1.00
IGL02377:Sptbn1 APN 11 30119491 missense possibly damaging 0.92
IGL02504:Sptbn1 APN 11 30142293 missense probably damaging 1.00
IGL02672:Sptbn1 APN 11 30137239 missense probably damaging 1.00
IGL02733:Sptbn1 APN 11 30197747 missense probably benign 0.12
IGL02755:Sptbn1 APN 11 30142247 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0006:Sptbn1 UTSW 11 30123855 missense probably damaging 1.00
R0096:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0139:Sptbn1 UTSW 11 30142289 missense probably benign 0.00
R0370:Sptbn1 UTSW 11 30121545 missense probably benign
R0389:Sptbn1 UTSW 11 30139250 missense possibly damaging 0.95
R0415:Sptbn1 UTSW 11 30149576 missense probably damaging 1.00
R0552:Sptbn1 UTSW 11 30145985 missense possibly damaging 0.92
R0601:Sptbn1 UTSW 11 30150008 missense probably damaging 1.00
R0609:Sptbn1 UTSW 11 30138979 missense probably damaging 1.00
R0675:Sptbn1 UTSW 11 30117903 missense probably damaging 1.00
R0708:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0711:Sptbn1 UTSW 11 30114739 missense probably damaging 1.00
R0729:Sptbn1 UTSW 11 30110902 missense probably damaging 0.96
R0755:Sptbn1 UTSW 11 30139016 missense probably damaging 1.00
R0892:Sptbn1 UTSW 11 30142201 missense probably damaging 1.00
R0927:Sptbn1 UTSW 11 30121591 missense probably damaging 1.00
R1102:Sptbn1 UTSW 11 30120785 missense possibly damaging 0.93
R1460:Sptbn1 UTSW 11 30138637 missense possibly damaging 0.50
R1479:Sptbn1 UTSW 11 30113909 missense probably damaging 1.00
R1496:Sptbn1 UTSW 11 30121498 missense probably damaging 1.00
R1649:Sptbn1 UTSW 11 30137301 missense probably damaging 0.97
R1663:Sptbn1 UTSW 11 30120783 missense possibly damaging 0.53
R1671:Sptbn1 UTSW 11 30142245 missense possibly damaging 0.57
R1680:Sptbn1 UTSW 11 30159371 missense possibly damaging 0.92
R1695:Sptbn1 UTSW 11 30136124 missense probably benign 0.13
R1868:Sptbn1 UTSW 11 30114781 missense possibly damaging 0.70
R1918:Sptbn1 UTSW 11 30142414 missense probably damaging 1.00
R1921:Sptbn1 UTSW 11 30104469 missense probably damaging 0.98
R2026:Sptbn1 UTSW 11 30104559 missense probably benign 0.02
R2038:Sptbn1 UTSW 11 30159293 critical splice donor site probably null
R2047:Sptbn1 UTSW 11 30138360 splice site probably benign
R2312:Sptbn1 UTSW 11 30154249 missense probably damaging 1.00
R3430:Sptbn1 UTSW 11 30219686 missense possibly damaging 0.67
R3624:Sptbn1 UTSW 11 30140593 missense probably damaging 1.00
R3723:Sptbn1 UTSW 11 30137335 missense possibly damaging 0.59
R3862:Sptbn1 UTSW 11 30142329 missense possibly damaging 0.63
R4446:Sptbn1 UTSW 11 30139114 missense possibly damaging 0.70
R4582:Sptbn1 UTSW 11 30219597 missense probably damaging 1.00
R4705:Sptbn1 UTSW 11 30100660 missense probably benign
R4707:Sptbn1 UTSW 11 30137197 missense possibly damaging 0.61
R4718:Sptbn1 UTSW 11 30154297 missense probably damaging 1.00
R4789:Sptbn1 UTSW 11 30117759 missense probably benign
R4824:Sptbn1 UTSW 11 30118295 missense possibly damaging 0.72
R4855:Sptbn1 UTSW 11 30142353 missense probably damaging 1.00
R5009:Sptbn1 UTSW 11 30124016 missense probably benign 0.05
R5071:Sptbn1 UTSW 11 30113854 critical splice donor site probably null
R5153:Sptbn1 UTSW 11 30121510 missense possibly damaging 0.82
R5334:Sptbn1 UTSW 11 30137364 missense possibly damaging 0.92
R5462:Sptbn1 UTSW 11 30100520 missense possibly damaging 0.94
R5523:Sptbn1 UTSW 11 30137560 missense probably damaging 1.00
R5707:Sptbn1 UTSW 11 30143174 missense possibly damaging 0.65
R5724:Sptbn1 UTSW 11 30144113 missense possibly damaging 0.91
R5738:Sptbn1 UTSW 11 30145941 missense probably damaging 1.00
R5864:Sptbn1 UTSW 11 30145925 missense probably damaging 1.00
R5895:Sptbn1 UTSW 11 30123978 missense probably damaging 0.99
R5932:Sptbn1 UTSW 11 30136136 missense probably damaging 1.00
R5966:Sptbn1 UTSW 11 30124873 missense probably damaging 1.00
R5984:Sptbn1 UTSW 11 30118464 missense probably damaging 1.00
R6155:Sptbn1 UTSW 11 30137403 missense probably damaging 0.99
R6163:Sptbn1 UTSW 11 30159443 nonsense probably null
R6226:Sptbn1 UTSW 11 30136054 missense probably damaging 1.00
R6271:Sptbn1 UTSW 11 30100660 missense probably benign 0.00
R6443:Sptbn1 UTSW 11 30139429 missense possibly damaging 0.56
R6591:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6691:Sptbn1 UTSW 11 30113984 missense probably damaging 0.99
R6751:Sptbn1 UTSW 11 30117859 missense probably damaging 1.00
R6823:Sptbn1 UTSW 11 30114787 missense probably damaging 1.00
R6863:Sptbn1 UTSW 11 30146777 missense possibly damaging 0.94
R6885:Sptbn1 UTSW 11 30138634 missense probably benign 0.26
R6892:Sptbn1 UTSW 11 30142187 missense probably benign 0.27
R6998:Sptbn1 UTSW 11 30100633 missense probably damaging 0.97
R7043:Sptbn1 UTSW 11 30103323 missense probably benign 0.02
R7092:Sptbn1 UTSW 11 30137119 missense possibly damaging 0.75
R7272:Sptbn1 UTSW 11 30114859 missense possibly damaging 0.93
R7301:Sptbn1 UTSW 11 30117798 nonsense probably null
R7379:Sptbn1 UTSW 11 30139292 missense possibly damaging 0.72
R7774:Sptbn1 UTSW 11 30142142 missense probably damaging 0.99
R7813:Sptbn1 UTSW 11 30138455 missense probably damaging 1.00
R7837:Sptbn1 UTSW 11 30138832 missense probably damaging 1.00
R7843:Sptbn1 UTSW 11 30154320 missense probably damaging 1.00
R7846:Sptbn1 UTSW 11 30142153 missense probably damaging 0.98
R7877:Sptbn1 UTSW 11 30129601 missense possibly damaging 0.94
R7902:Sptbn1 UTSW 11 30136048 missense probably damaging 1.00
R8060:Sptbn1 UTSW 11 30101616 missense probably damaging 0.99
R8116:Sptbn1 UTSW 11 30139117 missense probably damaging 1.00
R8169:Sptbn1 UTSW 11 30197783 missense possibly damaging 0.62
R8208:Sptbn1 UTSW 11 30124972 missense probably damaging 1.00
R8247:Sptbn1 UTSW 11 30113906 missense possibly damaging 0.84
Z1176:Sptbn1 UTSW 11 30137439 missense probably damaging 1.00
Z1176:Sptbn1 UTSW 11 30197787 missense probably benign 0.13
Z1177:Sptbn1 UTSW 11 30114734 missense probably damaging 1.00
Z1177:Sptbn1 UTSW 11 30120659 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AATACTGCCTTGCCCACTTG -3'
(R):5'- AACTTCCTGGATGAATGTAGGGAG -3'

Sequencing Primer
(F):5'- GCCATAGTCGTCAGATTGAATC -3'
(R):5'- ATGAATGTAGGGAGTGTGGATGC -3'
Posted On2018-06-22