Mutagenetix > Incidental Mutation

Incidental Mutation 'R6616:Sptbn1'

524071

Institutional Source

Beutler Lab

Gene Symbol

Sptbn1

Ensembl Gene

ENSMUSG00000020315

Gene Name

spectrin beta, non-erythrocytic 1

Synonyms

beta fodrin, Spnb-2, 9930031C03Rik, spectrin G, elf1, brain spectrin, elf3, Spnb2, non-erythrocytic

MMRRC Submission

044739-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6616 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30049395-30218175 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30074030 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 1346 (E1346D)

Ref Sequence

ENSEMBL: ENSMUSP00000114841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]

AlphaFold

Q62261

Predicted Effect

probably benign
Transcript: ENSMUST00000006629
AA Change: E1346D

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: E1346D

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000011877
AA Change: E1346D

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: E1346D

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102838
AA Change: E1333D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: E1333D

Domain	Start	End	E-Value	Type
CH	43	143	3.02e-28	SMART
CH	162	260	8.73e-25	SMART
SPEC	292	398	2.03e0	SMART
SPEC	412	512	6.42e-26	SMART
SPEC	518	622	4.61e-27	SMART
SPEC	628	728	2.36e-33	SMART
SPEC	734	833	1.2e-25	SMART
SPEC	839	939	7.16e-24	SMART
SPEC	945	1046	6.58e-23	SMART
SPEC	1052	1153	1.79e-24	SMART
SPEC	1159	1259	2.2e-24	SMART
SPEC	1265	1364	5.18e-21	SMART
SPEC	1370	1469	1.02e-19	SMART
SPEC	1475	1576	7.2e-29	SMART
SPEC	1582	1682	8.03e-27	SMART
SPEC	1688	1789	9.73e-26	SMART
SPEC	1795	1895	9.82e-22	SMART
SPEC	1901	2001	8.68e-23	SMART
SPEC	2007	2114	2.66e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124231
AA Change: E1346D

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: E1346D

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2092	6.42e-2	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	T	17: 24,603,509 (GRCm39)	H567L	probably damaging	Het
Adck1	T	A	12: 88,427,958 (GRCm39)	M525K	unknown	Het
Alpi	T	C	1: 87,028,836 (GRCm39)	I74V	possibly damaging	Het
Ccdc168	C	A	1: 44,100,634 (GRCm39)	V155L	possibly damaging	Het
Creb5	A	C	6: 53,662,295 (GRCm39)	Q197H	possibly damaging	Het
Cyp2b13	A	G	7: 25,785,306 (GRCm39)	K225R	probably benign	Het
Dock1	G	A	7: 134,710,221 (GRCm39)	E1143K	possibly damaging	Het
Eef2kmt	T	A	16: 5,065,346 (GRCm39)	D287V	probably damaging	Het
Eif2ak4	T	A	2: 118,285,326 (GRCm39)	Y1046*	probably null	Het
Fbxw10	T	A	11: 62,743,850 (GRCm39)	M252K	probably benign	Het
Fnip2	A	C	3: 79,388,189 (GRCm39)	H847Q	probably benign	Het
Frmd3	A	T	4: 74,105,725 (GRCm39)	D457V	probably damaging	Het
Gm13941	T	G	2: 110,931,520 (GRCm39)	E37D	unknown	Het
Grin1	T	A	2: 25,182,122 (GRCm39)	I870F	possibly damaging	Het
Grin2b	A	C	6: 135,709,549 (GRCm39)	D1332E	probably benign	Het
Gtpbp4	G	A	13: 9,039,141 (GRCm39)	T201I	possibly damaging	Het
Heatr4	A	G	12: 84,026,904 (GRCm39)	C118R	probably benign	Het
Hltf	T	A	3: 20,163,651 (GRCm39)		probably null	Het
Hmcn1	C	T	1: 150,599,008 (GRCm39)		probably null	Het
Hpd	A	T	5: 123,310,123 (GRCm39)	L367Q	probably damaging	Het
Htr1b	A	G	9: 81,514,487 (GRCm39)	I40T	probably benign	Het
Il16	A	G	7: 83,295,684 (GRCm39)	S464P	probably benign	Het
Lrp1b	T	A	2: 40,589,643 (GRCm39)	D75V	unknown	Het
Map3k4	A	T	17: 12,490,231 (GRCm39)	L400Q	probably damaging	Het
Mcts2	T	A	2: 152,529,582 (GRCm39)	I131N	possibly damaging	Het
Mroh2b	A	C	15: 4,982,764 (GRCm39)	I1528L	probably benign	Het
Muc4	A	C	16: 32,602,378 (GRCm39)	D3467A	possibly damaging	Het
Mypn	A	T	10: 63,005,091 (GRCm39)	C339S	probably damaging	Het
Ncoa5	A	T	2: 164,852,483 (GRCm39)	Y130*	probably null	Het
Or11g27	T	A	14: 50,771,364 (GRCm39)	I165N	probably benign	Het
Or2y11	T	A	11: 49,442,868 (GRCm39)	V98E	probably damaging	Het
Pcdha4	A	G	18: 37,086,953 (GRCm39)	T379A	probably benign	Het
Pkp4	C	G	2: 59,180,896 (GRCm39)	Y720*	probably null	Het
Prl5a1	C	T	13: 28,333,839 (GRCm39)	T114I	probably benign	Het
Rnd3	A	G	2: 51,024,169 (GRCm39)	S137P	probably damaging	Het
Rtel1	G	A	2: 180,994,579 (GRCm39)	E680K	possibly damaging	Het
Sbsn	T	A	7: 30,452,704 (GRCm39)	V573D	possibly damaging	Het
Scaf8	A	T	17: 3,218,330 (GRCm39)	L233F	unknown	Het
Sec23a	A	T	12: 59,043,941 (GRCm39)	I241K	possibly damaging	Het
Secisbp2l	A	T	2: 125,610,146 (GRCm39)	S258T	probably damaging	Het
Skint4	A	G	4: 111,975,427 (GRCm39)	H121R	possibly damaging	Het
Srsf11	C	T	3: 157,728,981 (GRCm39)		probably benign	Het
Stpg4	A	G	17: 87,730,124 (GRCm39)	Y74H	probably damaging	Het
Tenm4	G	A	7: 96,202,703 (GRCm39)	R106H	probably benign	Het
Tmc4	A	G	7: 3,674,057 (GRCm39)	V374A	possibly damaging	Het
Unc45b	G	A	11: 82,802,645 (GRCm39)	R47Q	probably damaging	Het
Xirp1	A	G	9: 119,848,080 (GRCm39)	S268P	probably damaging	Het
Zfp990	A	T	4: 145,263,715 (GRCm39)	I238L	probably benign	Het
Zswim5	A	G	4: 116,843,938 (GRCm39)	D992G	possibly damaging	Het

Other mutations in Sptbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sptbn1	APN	11	30,060,818 (GRCm39)	nonsense	probably null
IGL01098:Sptbn1	APN	11	30,109,385 (GRCm39)	missense	probably damaging	1.00
IGL01843:Sptbn1	APN	11	30,054,623 (GRCm39)	missense	probably benign	0.02
IGL02070:Sptbn1	APN	11	30,095,979 (GRCm39)	missense	probably damaging	0.99
IGL02075:Sptbn1	APN	11	30,088,496 (GRCm39)	missense	probably damaging	1.00
IGL02094:Sptbn1	APN	11	30,050,659 (GRCm39)	missense	probably benign	0.01
IGL02102:Sptbn1	APN	11	30,087,427 (GRCm39)	missense	probably damaging	1.00
IGL02189:Sptbn1	APN	11	30,067,871 (GRCm39)	missense	probably damaging	1.00
IGL02256:Sptbn1	APN	11	30,070,990 (GRCm39)	missense	probably benign	0.24
IGL02301:Sptbn1	APN	11	30,092,129 (GRCm39)	missense	probably damaging	1.00
IGL02354:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02361:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02377:Sptbn1	APN	11	30,069,491 (GRCm39)	missense	possibly damaging	0.92
IGL02504:Sptbn1	APN	11	30,092,293 (GRCm39)	missense	probably damaging	1.00
IGL02672:Sptbn1	APN	11	30,087,239 (GRCm39)	missense	probably damaging	1.00
IGL02733:Sptbn1	APN	11	30,147,747 (GRCm39)	missense	probably benign	0.12
IGL02755:Sptbn1	APN	11	30,092,247 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0096:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0139:Sptbn1	UTSW	11	30,092,289 (GRCm39)	missense	probably benign	0.00
R0370:Sptbn1	UTSW	11	30,071,545 (GRCm39)	missense	probably benign
R0389:Sptbn1	UTSW	11	30,089,250 (GRCm39)	missense	possibly damaging	0.95
R0415:Sptbn1	UTSW	11	30,099,576 (GRCm39)	missense	probably damaging	1.00
R0552:Sptbn1	UTSW	11	30,095,985 (GRCm39)	missense	possibly damaging	0.92
R0601:Sptbn1	UTSW	11	30,100,008 (GRCm39)	missense	probably damaging	1.00
R0609:Sptbn1	UTSW	11	30,088,979 (GRCm39)	missense	probably damaging	1.00
R0675:Sptbn1	UTSW	11	30,067,903 (GRCm39)	missense	probably damaging	1.00
R0708:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0711:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0729:Sptbn1	UTSW	11	30,060,902 (GRCm39)	missense	probably damaging	0.96
R0755:Sptbn1	UTSW	11	30,089,016 (GRCm39)	missense	probably damaging	1.00
R0892:Sptbn1	UTSW	11	30,092,201 (GRCm39)	missense	probably damaging	1.00
R0927:Sptbn1	UTSW	11	30,071,591 (GRCm39)	missense	probably damaging	1.00
R1102:Sptbn1	UTSW	11	30,070,785 (GRCm39)	missense	possibly damaging	0.93
R1460:Sptbn1	UTSW	11	30,088,637 (GRCm39)	missense	possibly damaging	0.50
R1479:Sptbn1	UTSW	11	30,063,909 (GRCm39)	missense	probably damaging	1.00
R1496:Sptbn1	UTSW	11	30,071,498 (GRCm39)	missense	probably damaging	1.00
R1649:Sptbn1	UTSW	11	30,087,301 (GRCm39)	missense	probably damaging	0.97
R1663:Sptbn1	UTSW	11	30,070,783 (GRCm39)	missense	possibly damaging	0.53
R1671:Sptbn1	UTSW	11	30,092,245 (GRCm39)	missense	possibly damaging	0.57
R1680:Sptbn1	UTSW	11	30,109,371 (GRCm39)	missense	possibly damaging	0.92
R1695:Sptbn1	UTSW	11	30,086,124 (GRCm39)	missense	probably benign	0.13
R1868:Sptbn1	UTSW	11	30,064,781 (GRCm39)	missense	possibly damaging	0.70
R1918:Sptbn1	UTSW	11	30,092,414 (GRCm39)	missense	probably damaging	1.00
R1921:Sptbn1	UTSW	11	30,054,469 (GRCm39)	missense	probably damaging	0.98
R2026:Sptbn1	UTSW	11	30,054,559 (GRCm39)	missense	probably benign	0.02
R2038:Sptbn1	UTSW	11	30,109,293 (GRCm39)	critical splice donor site	probably null
R2047:Sptbn1	UTSW	11	30,088,360 (GRCm39)	splice site	probably benign
R2312:Sptbn1	UTSW	11	30,104,249 (GRCm39)	missense	probably damaging	1.00
R3430:Sptbn1	UTSW	11	30,169,686 (GRCm39)	missense	possibly damaging	0.67
R3624:Sptbn1	UTSW	11	30,090,593 (GRCm39)	missense	probably damaging	1.00
R3723:Sptbn1	UTSW	11	30,087,335 (GRCm39)	missense	possibly damaging	0.59
R3862:Sptbn1	UTSW	11	30,092,329 (GRCm39)	missense	possibly damaging	0.63
R4446:Sptbn1	UTSW	11	30,089,114 (GRCm39)	missense	possibly damaging	0.70
R4582:Sptbn1	UTSW	11	30,169,597 (GRCm39)	missense	probably damaging	1.00
R4705:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign
R4707:Sptbn1	UTSW	11	30,087,197 (GRCm39)	missense	possibly damaging	0.61
R4718:Sptbn1	UTSW	11	30,104,297 (GRCm39)	missense	probably damaging	1.00
R4789:Sptbn1	UTSW	11	30,067,759 (GRCm39)	missense	probably benign
R4824:Sptbn1	UTSW	11	30,068,295 (GRCm39)	missense	possibly damaging	0.72
R4855:Sptbn1	UTSW	11	30,092,353 (GRCm39)	missense	probably damaging	1.00
R5009:Sptbn1	UTSW	11	30,074,016 (GRCm39)	missense	probably benign	0.05
R5071:Sptbn1	UTSW	11	30,063,854 (GRCm39)	critical splice donor site	probably null
R5153:Sptbn1	UTSW	11	30,071,510 (GRCm39)	missense	possibly damaging	0.82
R5334:Sptbn1	UTSW	11	30,087,364 (GRCm39)	missense	possibly damaging	0.92
R5462:Sptbn1	UTSW	11	30,050,520 (GRCm39)	missense	possibly damaging	0.94
R5523:Sptbn1	UTSW	11	30,087,560 (GRCm39)	missense	probably damaging	1.00
R5707:Sptbn1	UTSW	11	30,093,174 (GRCm39)	missense	possibly damaging	0.65
R5724:Sptbn1	UTSW	11	30,094,113 (GRCm39)	missense	possibly damaging	0.91
R5738:Sptbn1	UTSW	11	30,095,941 (GRCm39)	missense	probably damaging	1.00
R5864:Sptbn1	UTSW	11	30,095,925 (GRCm39)	missense	probably damaging	1.00
R5895:Sptbn1	UTSW	11	30,073,978 (GRCm39)	missense	probably damaging	0.99
R5932:Sptbn1	UTSW	11	30,086,136 (GRCm39)	missense	probably damaging	1.00
R5966:Sptbn1	UTSW	11	30,074,873 (GRCm39)	missense	probably damaging	1.00
R5984:Sptbn1	UTSW	11	30,068,464 (GRCm39)	missense	probably damaging	1.00
R6155:Sptbn1	UTSW	11	30,087,403 (GRCm39)	missense	probably damaging	0.99
R6163:Sptbn1	UTSW	11	30,109,443 (GRCm39)	nonsense	probably null
R6226:Sptbn1	UTSW	11	30,086,054 (GRCm39)	missense	probably damaging	1.00
R6271:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign	0.00
R6443:Sptbn1	UTSW	11	30,089,429 (GRCm39)	missense	possibly damaging	0.56
R6591:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6691:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6751:Sptbn1	UTSW	11	30,067,859 (GRCm39)	missense	probably damaging	1.00
R6823:Sptbn1	UTSW	11	30,064,787 (GRCm39)	missense	probably damaging	1.00
R6863:Sptbn1	UTSW	11	30,096,777 (GRCm39)	missense	possibly damaging	0.94
R6885:Sptbn1	UTSW	11	30,088,634 (GRCm39)	missense	probably benign	0.26
R6892:Sptbn1	UTSW	11	30,092,187 (GRCm39)	missense	probably benign	0.27
R6998:Sptbn1	UTSW	11	30,050,633 (GRCm39)	missense	probably damaging	0.97
R7043:Sptbn1	UTSW	11	30,053,323 (GRCm39)	missense	probably benign	0.02
R7092:Sptbn1	UTSW	11	30,087,119 (GRCm39)	missense	possibly damaging	0.75
R7272:Sptbn1	UTSW	11	30,064,859 (GRCm39)	missense	possibly damaging	0.93
R7301:Sptbn1	UTSW	11	30,067,798 (GRCm39)	nonsense	probably null
R7379:Sptbn1	UTSW	11	30,089,292 (GRCm39)	missense	possibly damaging	0.72
R7774:Sptbn1	UTSW	11	30,092,142 (GRCm39)	missense	probably damaging	0.99
R7813:Sptbn1	UTSW	11	30,088,455 (GRCm39)	missense	probably damaging	1.00
R7837:Sptbn1	UTSW	11	30,088,832 (GRCm39)	missense	probably damaging	1.00
R7843:Sptbn1	UTSW	11	30,104,320 (GRCm39)	missense	probably damaging	1.00
R7846:Sptbn1	UTSW	11	30,092,153 (GRCm39)	missense	probably damaging	0.98
R7877:Sptbn1	UTSW	11	30,079,601 (GRCm39)	missense	possibly damaging	0.94
R7902:Sptbn1	UTSW	11	30,086,048 (GRCm39)	missense	probably damaging	1.00
R8060:Sptbn1	UTSW	11	30,051,616 (GRCm39)	missense	probably damaging	0.99
R8116:Sptbn1	UTSW	11	30,089,117 (GRCm39)	missense	probably damaging	1.00
R8169:Sptbn1	UTSW	11	30,147,783 (GRCm39)	missense	possibly damaging	0.62
R8208:Sptbn1	UTSW	11	30,074,972 (GRCm39)	missense	probably damaging	1.00
R8247:Sptbn1	UTSW	11	30,063,906 (GRCm39)	missense	possibly damaging	0.84
R8412:Sptbn1	UTSW	11	30,088,457 (GRCm39)	missense	probably damaging	1.00
R8470:Sptbn1	UTSW	11	30,070,758 (GRCm39)	missense	possibly damaging	0.78
R8544:Sptbn1	UTSW	11	30,169,750 (GRCm39)	start gained	probably benign
R8674:Sptbn1	UTSW	11	30,089,352 (GRCm39)	missense	possibly damaging	0.73
R8846:Sptbn1	UTSW	11	30,075,009 (GRCm39)	missense	possibly damaging	0.77
R8889:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8892:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8927:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8928:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8975:Sptbn1	UTSW	11	30,073,869 (GRCm39)	missense	possibly damaging	0.86
R9115:Sptbn1	UTSW	11	30,087,526 (GRCm39)	missense	probably damaging	1.00
R9127:Sptbn1	UTSW	11	30,104,356 (GRCm39)	missense	probably damaging	1.00
R9193:Sptbn1	UTSW	11	30,087,551 (GRCm39)	missense	possibly damaging	0.77
R9237:Sptbn1	UTSW	11	30,096,803 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30,147,787 (GRCm39)	missense	probably benign	0.13
Z1176:Sptbn1	UTSW	11	30,087,439 (GRCm39)	missense	probably damaging	1.00
Z1177:Sptbn1	UTSW	11	30,070,659 (GRCm39)	missense	probably benign	0.27
Z1177:Sptbn1	UTSW	11	30,064,734 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATACTGCCTTGCCCACTTG -3'
(R):5'- AACTTCCTGGATGAATGTAGGGAG -3'

Sequencing Primer
(F):5'- GCCATAGTCGTCAGATTGAATC -3'
(R):5'- ATGAATGTAGGGAGTGTGGATGC -3'

Posted On

2018-06-22