Incidental Mutation 'R6616:Olfr1381'
ID524073
Institutional Source Beutler Lab
Gene Symbol Olfr1381
Ensembl Gene ENSMUSG00000095187
Gene Nameolfactory receptor 1381
SynonymsGA_x6K02T2QP88-5884501-5883566, MOR256-26
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49543449-49556127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49552041 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 98 (V98E)
Ref Sequence ENSEMBL: ENSMUSP00000149881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167248] [ENSMUST00000213256] [ENSMUST00000215360]
Predicted Effect probably damaging
Transcript: ENSMUST00000167248
AA Change: V98E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126003
Gene: ENSMUSG00000095187
AA Change: V98E

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.9e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 219 2.4e-5 PFAM
Pfam:7tm_1 41 289 1.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213256
AA Change: V98E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000215360
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Olfr1381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Olfr1381 APN 11 49552137 missense probably damaging 1.00
IGL02166:Olfr1381 APN 11 49551930 missense probably damaging 1.00
IGL02723:Olfr1381 APN 11 49552679 missense probably benign 0.28
R0518:Olfr1381 UTSW 11 49552464 missense probably damaging 1.00
R0521:Olfr1381 UTSW 11 49552464 missense probably damaging 1.00
R2109:Olfr1381 UTSW 11 49552433 missense probably damaging 1.00
R4198:Olfr1381 UTSW 11 49552634 missense possibly damaging 0.61
R6155:Olfr1381 UTSW 11 49552584 missense possibly damaging 0.93
R6181:Olfr1381 UTSW 11 49552293 missense probably damaging 0.97
R6250:Olfr1381 UTSW 11 49551884 missense probably damaging 1.00
R6372:Olfr1381 UTSW 11 49551930 missense probably damaging 1.00
R7391:Olfr1381 UTSW 11 49552544 missense probably damaging 1.00
Z1177:Olfr1381 UTSW 11 49552284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAACACCGTGATCATCATTC -3'
(R):5'- TGATTCAGTTGGTGTCCACAC -3'

Sequencing Primer
(F):5'- GTGATCATCATTCTGTCTCGACTGG -3'
(R):5'- CATCACAAGGCTTGTCTGGATCAG -3'
Posted On2018-06-22