Incidental Mutation 'R6580:Hfm1'
ID 524074
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 044704-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R6580 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 106988058-107074187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 106995575 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1279 (E1279K)
Ref Sequence ENSEMBL: ENSMUSP00000112590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]
AlphaFold D3Z4R1
Predicted Effect probably benign
Transcript: ENSMUST00000112690
AA Change: E1279K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: E1279K

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117588
AA Change: E1279K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: E1279K

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect unknown
Transcript: ENSMUST00000155171
AA Change: E492K
SMART Domains Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410
AA Change: E492K

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Sec63 33 304 3.04e-42 SMART
Blast:Sec63 344 402 7e-19 BLAST
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,772,386 (GRCm39) R525H probably benign Het
Acox3 T A 5: 35,765,747 (GRCm39) L600Q probably damaging Het
Ankrd49 A G 9: 14,692,694 (GRCm39) S157P probably damaging Het
Ccdc141 A G 2: 76,842,099 (GRCm39) F1444S possibly damaging Het
Cimap2 G T 4: 106,468,711 (GRCm39) H271N possibly damaging Het
Defb28 C T 2: 152,360,215 (GRCm39) S10L possibly damaging Het
Epha6 T G 16: 59,502,979 (GRCm39) N976T probably damaging Het
Gm45861 A G 8: 28,034,979 (GRCm39) K976E unknown Het
Gtf2ird1 T G 5: 134,389,893 (GRCm39) N920H probably damaging Het
Gtf3c1 A T 7: 125,243,519 (GRCm39) M1695K probably benign Het
Il31ra C T 13: 112,688,476 (GRCm39) D34N possibly damaging Het
Klhl3 T A 13: 58,166,701 (GRCm39) I430F possibly damaging Het
Mfhas1 A G 8: 36,056,419 (GRCm39) Y298C probably damaging Het
Muc20 A T 16: 32,613,859 (GRCm39) M506K possibly damaging Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Naip1 T A 13: 100,581,157 (GRCm39) D30V probably damaging Het
Nol9 A G 4: 152,136,218 (GRCm39) N430S probably benign Het
Or8b44 T C 9: 38,410,319 (GRCm39) M118T probably damaging Het
Palm3 A G 8: 84,756,177 (GRCm39) E563G probably damaging Het
Pcdhga4 A G 18: 37,820,370 (GRCm39) S640G possibly damaging Het
Pi4ka A G 16: 17,168,694 (GRCm39) F679L probably damaging Het
Pierce1 A G 2: 28,356,062 (GRCm39) W74R probably damaging Het
Polr3c A G 3: 96,634,659 (GRCm39) probably null Het
Ptdss2 T A 7: 140,732,925 (GRCm39) I236N probably damaging Het
Rapgef1 A G 2: 29,620,621 (GRCm39) Y879C possibly damaging Het
Shc3 T C 13: 51,596,809 (GRCm39) T405A probably benign Het
Smtnl2 G T 11: 72,293,859 (GRCm39) S232R probably benign Het
Taar8a G A 10: 23,952,791 (GRCm39) A132T probably damaging Het
Tex47 T C 5: 7,355,212 (GRCm39) I131T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,464,897 (GRCm39) probably null Het
Vmn1r63 A G 7: 5,805,913 (GRCm39) S240P probably benign Het
Vmn2r130 T C 17: 23,282,740 (GRCm39) V140A probably benign Het
Vmn2r84 A G 10: 130,225,110 (GRCm39) W467R possibly damaging Het
Zscan12 T C 13: 21,553,328 (GRCm39) L384P probably damaging Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 107,049,996 (GRCm39) missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 107,065,472 (GRCm39) missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 107,065,245 (GRCm39) missense probably benign 0.00
IGL01758:Hfm1 APN 5 107,052,659 (GRCm39) missense probably damaging 0.99
IGL01911:Hfm1 APN 5 107,059,410 (GRCm39) missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 107,052,133 (GRCm39) missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 107,021,794 (GRCm39) splice site probably benign
IGL02496:Hfm1 APN 5 107,049,627 (GRCm39) missense probably benign 0.00
IGL02545:Hfm1 APN 5 107,043,153 (GRCm39) missense probably damaging 1.00
IGL02584:Hfm1 APN 5 107,026,528 (GRCm39) splice site probably null
IGL02728:Hfm1 APN 5 107,026,689 (GRCm39) missense probably benign 0.13
IGL02881:Hfm1 APN 5 107,022,118 (GRCm39) missense probably damaging 1.00
IGL03108:Hfm1 APN 5 107,043,800 (GRCm39) unclassified probably benign
IGL03351:Hfm1 APN 5 107,059,441 (GRCm39) nonsense probably null
IGL03353:Hfm1 APN 5 107,004,795 (GRCm39) missense probably damaging 0.99
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0094:Hfm1 UTSW 5 107,065,344 (GRCm39) missense probably benign
R0633:Hfm1 UTSW 5 107,065,467 (GRCm39) missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 107,046,122 (GRCm39) critical splice donor site probably null
R1078:Hfm1 UTSW 5 107,026,696 (GRCm39) missense probably damaging 1.00
R1120:Hfm1 UTSW 5 107,052,084 (GRCm39) splice site probably benign
R1166:Hfm1 UTSW 5 107,059,277 (GRCm39) missense probably benign 0.00
R1242:Hfm1 UTSW 5 107,022,767 (GRCm39) missense probably damaging 0.99
R1414:Hfm1 UTSW 5 107,020,219 (GRCm39) missense probably benign 0.01
R1450:Hfm1 UTSW 5 107,066,324 (GRCm39) missense probably damaging 0.99
R1529:Hfm1 UTSW 5 107,000,989 (GRCm39) missense probably benign 0.00
R1622:Hfm1 UTSW 5 107,041,389 (GRCm39) missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 107,043,869 (GRCm39) missense probably damaging 0.96
R1710:Hfm1 UTSW 5 107,028,380 (GRCm39) missense probably damaging 1.00
R1757:Hfm1 UTSW 5 107,028,226 (GRCm39) splice site probably null
R1856:Hfm1 UTSW 5 106,995,542 (GRCm39) missense probably benign 0.00
R1984:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R1985:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R2040:Hfm1 UTSW 5 107,049,684 (GRCm39) missense probably damaging 1.00
R2122:Hfm1 UTSW 5 107,044,121 (GRCm39) missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106,995,519 (GRCm39) splice site probably null
R2474:Hfm1 UTSW 5 107,020,282 (GRCm39) missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 107,022,148 (GRCm39) nonsense probably null
R2944:Hfm1 UTSW 5 107,020,196 (GRCm39) missense probably damaging 1.00
R3705:Hfm1 UTSW 5 107,040,705 (GRCm39) unclassified probably benign
R4256:Hfm1 UTSW 5 107,052,663 (GRCm39) missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 107,034,374 (GRCm39) splice site probably null
R4538:Hfm1 UTSW 5 107,022,756 (GRCm39) missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 107,022,087 (GRCm39) nonsense probably null
R4591:Hfm1 UTSW 5 106,995,533 (GRCm39) missense probably benign 0.08
R4745:Hfm1 UTSW 5 107,049,709 (GRCm39) missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 107,065,389 (GRCm39) missense probably benign
R4765:Hfm1 UTSW 5 106,990,405 (GRCm39) missense probably benign 0.21
R4821:Hfm1 UTSW 5 107,002,606 (GRCm39) critical splice donor site probably null
R4842:Hfm1 UTSW 5 107,040,617 (GRCm39) missense probably damaging 1.00
R4944:Hfm1 UTSW 5 107,022,079 (GRCm39) missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 107,049,597 (GRCm39) missense probably damaging 1.00
R5399:Hfm1 UTSW 5 107,065,428 (GRCm39) missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 107,049,942 (GRCm39) missense probably damaging 1.00
R5436:Hfm1 UTSW 5 107,040,638 (GRCm39) missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106,995,528 (GRCm39) critical splice donor site probably null
R5585:Hfm1 UTSW 5 107,059,305 (GRCm39) missense probably benign 0.05
R5631:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5705:Hfm1 UTSW 5 107,059,319 (GRCm39) missense probably benign 0.21
R5804:Hfm1 UTSW 5 107,026,455 (GRCm39) splice site probably null
R5959:Hfm1 UTSW 5 107,022,783 (GRCm39) missense probably damaging 1.00
R6046:Hfm1 UTSW 5 107,046,509 (GRCm39) splice site probably null
R6191:Hfm1 UTSW 5 107,034,419 (GRCm39) missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106,989,504 (GRCm39) missense probably benign
R6651:Hfm1 UTSW 5 106,995,553 (GRCm39) missense probably benign 0.00
R6761:Hfm1 UTSW 5 107,043,145 (GRCm39) missense probably damaging 1.00
R6835:Hfm1 UTSW 5 107,026,681 (GRCm39) nonsense probably null
R6891:Hfm1 UTSW 5 107,065,240 (GRCm39) missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106,998,276 (GRCm39) splice site probably null
R6980:Hfm1 UTSW 5 107,028,343 (GRCm39) missense probably benign 0.31
R7054:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7058:Hfm1 UTSW 5 107,059,306 (GRCm39) missense probably benign 0.04
R7189:Hfm1 UTSW 5 107,049,569 (GRCm39) critical splice donor site probably null
R7250:Hfm1 UTSW 5 107,052,197 (GRCm39) missense probably benign 0.00
R7376:Hfm1 UTSW 5 107,043,084 (GRCm39) missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7636:Hfm1 UTSW 5 107,065,332 (GRCm39) missense probably benign 0.02
R7639:Hfm1 UTSW 5 107,046,341 (GRCm39) missense possibly damaging 0.46
R7639:Hfm1 UTSW 5 107,037,791 (GRCm39) missense probably benign 0.03
R7763:Hfm1 UTSW 5 107,029,727 (GRCm39) missense probably damaging 1.00
R7828:Hfm1 UTSW 5 107,029,657 (GRCm39) critical splice donor site probably null
R7905:Hfm1 UTSW 5 107,046,419 (GRCm39) missense probably damaging 1.00
R8160:Hfm1 UTSW 5 107,043,899 (GRCm39) missense probably null 0.00
R8477:Hfm1 UTSW 5 107,029,684 (GRCm39) missense probably benign 0.01
R8739:Hfm1 UTSW 5 107,046,371 (GRCm39) missense probably damaging 0.96
R8968:Hfm1 UTSW 5 107,065,439 (GRCm39) missense probably benign 0.00
R9072:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9073:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9152:Hfm1 UTSW 5 106,989,611 (GRCm39) missense probably benign 0.01
R9234:Hfm1 UTSW 5 107,041,334 (GRCm39) missense probably benign
R9244:Hfm1 UTSW 5 107,022,766 (GRCm39) missense probably damaging 0.96
R9576:Hfm1 UTSW 5 107,021,938 (GRCm39) missense probably benign 0.00
R9649:Hfm1 UTSW 5 107,066,329 (GRCm39) missense possibly damaging 0.82
R9743:Hfm1 UTSW 5 107,022,125 (GRCm39) missense possibly damaging 0.55
R9782:Hfm1 UTSW 5 107,021,896 (GRCm39) missense probably benign 0.38
R9789:Hfm1 UTSW 5 107,065,346 (GRCm39) missense probably benign 0.00
Z1177:Hfm1 UTSW 5 107,019,686 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGGGAAAATGCTCTTTGTG -3'
(R):5'- TGTACAACTTCAAGTGAAAAGACCC -3'

Sequencing Primer
(F):5'- GGAAAATGCTCTTTGTGGAAAAG -3'
(R):5'- CCTCAAACGGTGATGTTCAGCAG -3'
Posted On 2018-06-22