Mutagenetix > Incidental Mutations

Incidental Mutation 'R6580:Hfm1'

524074

Institutional Source

Beutler Lab

Gene Symbol

Hfm1

Ensembl Gene

ENSMUSG00000043410

Gene Name

HFM1, ATP-dependent DNA helicase homolog

Synonyms

LOC381663, A330009G12Rik, Mer3, Sec63d1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R6580 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106840192-106926321 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106847709 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1279 (E1279K)

Ref Sequence

ENSEMBL: ENSMUSP00000112590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]

Predicted Effect

probably benign
Transcript: ENSMUST00000112690
AA Change: E1279K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: E1279K

Domain	Start	End	E-Value	Type
DEXDc	276	490	3.66e-29	SMART
HELICc	571	657	1.56e-14	SMART
low complexity region	751	764	N/A	INTRINSIC
Sec63	775	1090	5.66e-60	SMART
Blast:Sec63	1130	1188	2e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000117588
AA Change: E1279K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: E1279K

Domain	Start	End	E-Value	Type
DEXDc	276	490	3.66e-29	SMART
HELICc	571	657	1.56e-14	SMART
low complexity region	751	764	N/A	INTRINSIC
Sec63	775	1090	5.66e-60	SMART
Blast:Sec63	1130	1188	2e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000148495

Predicted Effect

unknown
Transcript: ENSMUST00000155171
AA Change: E492K

SMART Domains

Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410
AA Change: E492K

Domain	Start	End	E-Value	Type
low complexity region	9	22	N/A	INTRINSIC
Sec63	33	304	3.04e-42	SMART
Blast:Sec63	344	402	7e-19	BLAST

Meta Mutation Damage Score

0.0736

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

97% (32/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	A	3: 138,066,625	R525H	probably benign	Het
1700007K13Rik	A	G	2: 28,466,050	W74R	probably damaging	Het
Acox3	T	A	5: 35,608,403	L600Q	probably damaging	Het
Ankrd49	A	G	9: 14,781,398	S157P	probably damaging	Het
Ccdc141	A	G	2: 77,011,755	F1444S	possibly damaging	Het
Defb28	C	T	2: 152,518,295	S10L	possibly damaging	Het
Epha6	T	G	16: 59,682,616	N976T	probably damaging	Het
Gm45861	A	G	8: 27,544,951	K976E	unknown	Het
Gtf2ird1	T	G	5: 134,361,039	N920H	probably damaging	Het
Gtf3c1	A	T	7: 125,644,347	M1695K	probably benign	Het
Il31ra	C	T	13: 112,551,942	D34N	possibly damaging	Het
Klhl3	T	A	13: 58,018,887	I430F	possibly damaging	Het
Lexm	G	T	4: 106,611,514	H271N	possibly damaging	Het
Mfhas1	A	G	8: 35,589,265	Y298C	probably damaging	Het
Muc20	A	T	16: 32,793,489	M506K	possibly damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Naip1	T	A	13: 100,444,649	D30V	probably damaging	Het
Nol9	A	G	4: 152,051,761	N430S	probably benign	Het
Olfr907	T	C	9: 38,499,023	M118T	probably damaging	Het
Palm3	A	G	8: 84,029,548	E563G	probably damaging	Het
Pcdhga4	A	G	18: 37,687,317	S640G	possibly damaging	Het
Pi4ka	A	G	16: 17,350,830	F679L	probably damaging	Het
Polr3c	A	G	3: 96,727,343		probably null	Het
Ptdss2	T	A	7: 141,153,012	I236N	probably damaging	Het
Rapgef1	A	G	2: 29,730,609	Y879C	possibly damaging	Het
Shc3	T	C	13: 51,442,773	T405A	probably benign	Het
Smtnl2	G	T	11: 72,403,033	S232R	probably benign	Het
Taar8a	G	A	10: 24,076,893	A132T	probably damaging	Het
Tex47	T	C	5: 7,305,212	I131T	probably damaging	Het
Tiam2	CGGG	CGGGG	17: 3,414,622		probably null	Het
Vmn1r63	A	G	7: 5,802,914	S240P	probably benign	Het
Vmn2r84	A	G	10: 130,389,241	W467R	possibly damaging	Het
Vmn2r-ps130	T	C	17: 23,063,766	V140A	probably benign	Het
Zscan12	T	C	13: 21,369,158	L384P	probably damaging	Het

Other mutations in Hfm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Hfm1	APN	5	106902130	missense	possibly damaging	0.70
IGL01295:Hfm1	APN	5	106917606	missense	possibly damaging	0.46
IGL01725:Hfm1	APN	5	106917379	missense	probably benign	0.00
IGL01758:Hfm1	APN	5	106904793	missense	probably damaging	0.99
IGL01911:Hfm1	APN	5	106911544	missense	possibly damaging	0.92
IGL02337:Hfm1	APN	5	106904267	missense	possibly damaging	0.81
IGL02472:Hfm1	APN	5	106873928	splice site	probably benign
IGL02496:Hfm1	APN	5	106901761	missense	probably benign	0.00
IGL02545:Hfm1	APN	5	106895287	missense	probably damaging	1.00
IGL02584:Hfm1	APN	5	106878662	splice site	probably null
IGL02728:Hfm1	APN	5	106878823	missense	probably benign	0.13
IGL02881:Hfm1	APN	5	106874252	missense	probably damaging	1.00
IGL03108:Hfm1	APN	5	106895934	unclassified	probably benign
IGL03351:Hfm1	APN	5	106911575	nonsense	probably null
IGL03353:Hfm1	APN	5	106856929	missense	probably damaging	0.99
R0024:Hfm1	UTSW	5	106856924	missense	probably benign	0.41
R0024:Hfm1	UTSW	5	106856924	missense	probably benign	0.41
R0094:Hfm1	UTSW	5	106917478	missense	probably benign
R0633:Hfm1	UTSW	5	106917601	missense	possibly damaging	0.56
R0644:Hfm1	UTSW	5	106898256	critical splice donor site	probably null
R1078:Hfm1	UTSW	5	106878830	missense	probably damaging	1.00
R1120:Hfm1	UTSW	5	106904218	splice site	probably benign
R1166:Hfm1	UTSW	5	106911411	missense	probably benign	0.00
R1242:Hfm1	UTSW	5	106874901	missense	probably damaging	0.99
R1414:Hfm1	UTSW	5	106872353	missense	probably benign	0.01
R1450:Hfm1	UTSW	5	106918458	missense	probably damaging	0.99
R1529:Hfm1	UTSW	5	106853123	missense	probably benign	0.00
R1622:Hfm1	UTSW	5	106893523	missense	possibly damaging	0.58
R1710:Hfm1	UTSW	5	106880514	missense	probably damaging	1.00
R1710:Hfm1	UTSW	5	106896003	missense	probably damaging	0.96
R1757:Hfm1	UTSW	5	106880360	splice site	probably null
R1856:Hfm1	UTSW	5	106847676	missense	probably benign	0.00
R1984:Hfm1	UTSW	5	106898576	missense	probably damaging	0.98
R1985:Hfm1	UTSW	5	106898576	missense	probably damaging	0.98
R2040:Hfm1	UTSW	5	106901818	missense	probably damaging	1.00
R2122:Hfm1	UTSW	5	106896255	missense	probably damaging	1.00
R2426:Hfm1	UTSW	5	106847653	splice site	probably null
R2474:Hfm1	UTSW	5	106872416	missense	possibly damaging	0.81
R2926:Hfm1	UTSW	5	106874282	nonsense	probably null
R2944:Hfm1	UTSW	5	106872330	missense	probably damaging	1.00
R3705:Hfm1	UTSW	5	106892839	unclassified	probably benign
R4256:Hfm1	UTSW	5	106904797	missense	possibly damaging	0.83
R4455:Hfm1	UTSW	5	106886508	splice site	probably null
R4538:Hfm1	UTSW	5	106874890	missense	possibly damaging	0.47
R4540:Hfm1	UTSW	5	106874221	nonsense	probably null
R4591:Hfm1	UTSW	5	106847667	missense	probably benign	0.08
R4745:Hfm1	UTSW	5	106901843	missense	possibly damaging	0.87
R4747:Hfm1	UTSW	5	106917523	missense	probably benign
R4765:Hfm1	UTSW	5	106842539	missense	probably benign	0.21
R4821:Hfm1	UTSW	5	106854740	critical splice donor site	probably null
R4842:Hfm1	UTSW	5	106892751	missense	probably damaging	1.00
R4944:Hfm1	UTSW	5	106874213	missense	possibly damaging	0.46
R5093:Hfm1	UTSW	5	106901731	missense	probably damaging	1.00
R5399:Hfm1	UTSW	5	106917562	missense	possibly damaging	0.91
R5414:Hfm1	UTSW	5	106902076	missense	probably damaging	1.00
R5436:Hfm1	UTSW	5	106892772	missense	possibly damaging	0.61
R5459:Hfm1	UTSW	5	106904763	missense	probably damaging	1.00
R5485:Hfm1	UTSW	5	106847662	critical splice donor site	probably null
R5585:Hfm1	UTSW	5	106911439	missense	probably benign	0.05
R5631:Hfm1	UTSW	5	106904763	missense	probably damaging	1.00
R5705:Hfm1	UTSW	5	106911453	missense	probably benign	0.21
R5804:Hfm1	UTSW	5	106878589	splice site	probably null
R5959:Hfm1	UTSW	5	106874917	missense	probably damaging	1.00
R6046:Hfm1	UTSW	5	106898643	splice site	probably null
R6191:Hfm1	UTSW	5	106886553	missense	possibly damaging	0.95
R6345:Hfm1	UTSW	5	106841638	missense	probably benign
R6651:Hfm1	UTSW	5	106847687	missense	probably benign	0.00
R6761:Hfm1	UTSW	5	106895279	missense	probably damaging	1.00
R6835:Hfm1	UTSW	5	106878815	nonsense	probably null
R6891:Hfm1	UTSW	5	106917374	missense	possibly damaging	0.49
R6924:Hfm1	UTSW	5	106850410	splice site	probably null
R6980:Hfm1	UTSW	5	106880477	missense	probably benign	0.31
R7054:Hfm1	UTSW	5	106896043	missense	probably benign	0.01
R7058:Hfm1	UTSW	5	106911440	missense	probably benign	0.04
R7189:Hfm1	UTSW	5	106901703	critical splice donor site	probably null
R7250:Hfm1	UTSW	5	106904331	missense	probably benign	0.00
R7376:Hfm1	UTSW	5	106895218	missense	possibly damaging	0.95
R7577:Hfm1	UTSW	5	106896043	missense	probably benign	0.01
R7636:Hfm1	UTSW	5	106917466	missense	probably benign	0.02
R7639:Hfm1	UTSW	5	106889925	missense	probably benign	0.03
R7639:Hfm1	UTSW	5	106898475	missense	possibly damaging	0.46
R7763:Hfm1	UTSW	5	106881861	missense	probably damaging	1.00
R7828:Hfm1	UTSW	5	106881791	critical splice donor site	probably null
R7905:Hfm1	UTSW	5	106898553	missense	probably damaging	1.00
R8160:Hfm1	UTSW	5	106896033	missense	probably null	0.00
R8477:Hfm1	UTSW	5	106881818	missense	probably benign	0.01
R8739:Hfm1	UTSW	5	106898505	missense	probably damaging	0.96
Z1177:Hfm1	UTSW	5	106871820	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGAGGGAAAATGCTCTTTGTG -3'
(R):5'- TGTACAACTTCAAGTGAAAAGACCC -3'

Sequencing Primer
(F):5'- GGAAAATGCTCTTTGTGGAAAAG -3'
(R):5'- CCTCAAACGGTGATGTTCAGCAG -3'

Posted On

2018-06-22