Incidental Mutation 'R6616:Unc45b'
ID524077
Institutional Source Beutler Lab
Gene Symbol Unc45b
Ensembl Gene ENSMUSG00000018845
Gene Nameunc-45 myosin chaperone B
SynonymsCmya4, D230041A13Rik, UNC45
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6616 (G1)
Quality Score187.009
Status Validated
Chromosome11
Chromosomal Location82910550-82943403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82911819 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 47 (R47Q)
Ref Sequence ENSEMBL: ENSMUSP00000129405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018989] [ENSMUST00000103213] [ENSMUST00000108160] [ENSMUST00000164945]
Predicted Effect probably damaging
Transcript: ENSMUST00000018989
AA Change: R47Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018989
Gene: ENSMUSG00000018845
AA Change: R47Q

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 541 582 7e-7 BLAST
Blast:ARM 661 701 2e-14 BLAST
Blast:ARM 704 746 5e-11 BLAST
Blast:ARM 747 788 1e-20 BLAST
Blast:ARM 789 820 1e-11 BLAST
low complexity region 821 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103213
SMART Domains Protein: ENSMUSP00000099502
Gene: ENSMUSG00000020692

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NLE 17 77 3.6e-15 PFAM
WD40 103 142 5.22e-12 SMART
WD40 145 184 1.48e-11 SMART
WD40 188 232 1.66e-5 SMART
WD40 235 273 3.11e-10 SMART
WD40 276 357 1.14e-3 SMART
WD40 361 400 8.81e-10 SMART
WD40 403 442 1.69e-11 SMART
WD40 445 484 9.44e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108160
AA Change: R47Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103795
Gene: ENSMUSG00000018845
AA Change: R47Q

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 271 489 2.2e-52 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126202
SMART Domains Protein: ENSMUSP00000130605
Gene: ENSMUSG00000020692

DomainStartEndE-ValueType
SCOP:d1flga_ 12 46 2e-5 SMART
Blast:WD40 22 48 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147915
Predicted Effect probably damaging
Transcript: ENSMUST00000164945
AA Change: R47Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129405
Gene: ENSMUSG00000018845
AA Change: R47Q

DomainStartEndE-ValueType
TPR 6 39 1.02e1 SMART
TPR 43 76 7.47e0 SMART
TPR 77 110 2.52e-1 SMART
Blast:ARM 167 208 3e-16 BLAST
Blast:ARM 210 250 1e-10 BLAST
Pfam:UNC45-central 298 489 1.7e-41 PFAM
Blast:ARM 663 703 2e-14 BLAST
Blast:ARM 706 748 5e-11 BLAST
Blast:ARM 749 790 1e-20 BLAST
Blast:ARM 791 822 1e-11 BLAST
low complexity region 823 834 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a co-chaperone required for folding and accumulation of type II myosins. The protein consists of three tetratricopeptide repeat motifs at the N-terminus that form a complex with heat shock protein 90, a central region of unknown function that is conserved in all Unc-45 proteins, and a C-terminal Unc-45/Cro1/She4 domain. The protein is expressed at high levels in striated muscle, where its muscle myosin chaperone activity is dependent on heat shock protein 90 acting as a co-chaperone. A missense mutation in this gene has been associated with cataract development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E9 without placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Unc45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Unc45b APN 11 82912393 critical splice acceptor site probably null
IGL01983:Unc45b APN 11 82936861 missense probably benign
IGL02083:Unc45b APN 11 82922919 missense probably damaging 0.96
IGL02159:Unc45b APN 11 82940181 splice site probably benign
IGL02160:Unc45b APN 11 82940181 splice site probably benign
IGL02165:Unc45b APN 11 82940181 splice site probably benign
IGL02166:Unc45b APN 11 82940181 splice site probably benign
IGL02986:Unc45b APN 11 82917179 missense probably damaging 0.98
fife UTSW 11 82936852 missense probably benign 0.00
mr_chicken UTSW 11 82913212 missense probably benign 0.00
R0195:Unc45b UTSW 11 82937828 missense probably damaging 1.00
R0197:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0218:Unc45b UTSW 11 82911860 splice site probably benign
R0436:Unc45b UTSW 11 82929567 splice site probably benign
R0569:Unc45b UTSW 11 82936812 splice site probably benign
R0701:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R0883:Unc45b UTSW 11 82940205 missense possibly damaging 0.78
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1146:Unc45b UTSW 11 82922907 missense probably damaging 0.99
R1378:Unc45b UTSW 11 82936852 missense probably benign 0.00
R1446:Unc45b UTSW 11 82928670 missense probably damaging 1.00
R1532:Unc45b UTSW 11 82936874 missense probably benign 0.12
R1559:Unc45b UTSW 11 82917846 missense possibly damaging 0.66
R1582:Unc45b UTSW 11 82925945 missense probably benign 0.30
R1628:Unc45b UTSW 11 82929380 intron probably null
R1666:Unc45b UTSW 11 82917739 missense probably benign 0.31
R1677:Unc45b UTSW 11 82911705 unclassified probably null
R1759:Unc45b UTSW 11 82929499 missense probably benign 0.33
R1909:Unc45b UTSW 11 82926087 missense probably damaging 1.00
R2067:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2111:Unc45b UTSW 11 82911689 missense probably benign 0.01
R2145:Unc45b UTSW 11 82917754 missense probably benign 0.30
R2258:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2259:Unc45b UTSW 11 82917799 missense probably benign 0.01
R2497:Unc45b UTSW 11 82936443 missense probably damaging 1.00
R2507:Unc45b UTSW 11 82940137 intron probably null
R4352:Unc45b UTSW 11 82913209 missense probably damaging 0.99
R4569:Unc45b UTSW 11 82936489 critical splice donor site probably null
R4624:Unc45b UTSW 11 82926009 missense probably benign 0.30
R5236:Unc45b UTSW 11 82915062 missense possibly damaging 0.53
R5512:Unc45b UTSW 11 82915072 missense possibly damaging 0.47
R5688:Unc45b UTSW 11 82922817 missense possibly damaging 0.88
R6029:Unc45b UTSW 11 82913327 missense probably damaging 1.00
R6857:Unc45b UTSW 11 82913212 missense probably benign 0.00
R6876:Unc45b UTSW 11 82922912 missense probably benign 0.00
R7197:Unc45b UTSW 11 82940187 critical splice acceptor site probably null
R7368:Unc45b UTSW 11 82942495 missense probably benign 0.01
R7531:Unc45b UTSW 11 82929012 missense probably damaging 1.00
T0970:Unc45b UTSW 11 82922888 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAAAAGCCTTGTCCTGGGTG -3'
(R):5'- TTCCTGCTTCTCTAGAGCAGTGG -3'

Sequencing Primer
(F):5'- TGGGTGTCCAGCAAAAGGC -3'
(R):5'- CAGTGGCCGGGGTAACAG -3'
Posted On2018-06-22