Incidental Mutation 'R6580:Gtf3c1'
ID524080
Institutional Source Beutler Lab
Gene Symbol Gtf3c1
Ensembl Gene ENSMUSG00000032777
Gene Namegeneral transcription factor III C 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6580 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location125640954-125707780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125644347 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1695 (M1695K)
Ref Sequence ENSEMBL: ENSMUSP00000145939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055506] [ENSMUST00000205659] [ENSMUST00000206183]
Predicted Effect probably benign
Transcript: ENSMUST00000055506
AA Change: M1791K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000056719
Gene: ENSMUSG00000032777
AA Change: M1791K

DomainStartEndE-ValueType
Pfam:B-block_TFIIIC 174 250 5.1e-20 PFAM
low complexity region 344 354 N/A INTRINSIC
low complexity region 474 514 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 725 745 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 1158 1173 N/A INTRINSIC
low complexity region 1359 1372 N/A INTRINSIC
low complexity region 1423 1443 N/A INTRINSIC
low complexity region 1585 1620 N/A INTRINSIC
low complexity region 1895 1915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205659
AA Change: M1695K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206042
Predicted Effect probably benign
Transcript: ENSMUST00000206183
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,625 R525H probably benign Het
1700007K13Rik A G 2: 28,466,050 W74R probably damaging Het
Acox3 T A 5: 35,608,403 L600Q probably damaging Het
Ankrd49 A G 9: 14,781,398 S157P probably damaging Het
Ccdc141 A G 2: 77,011,755 F1444S possibly damaging Het
Defb28 C T 2: 152,518,295 S10L possibly damaging Het
Epha6 T G 16: 59,682,616 N976T probably damaging Het
Gm45861 A G 8: 27,544,951 K976E unknown Het
Gtf2ird1 T G 5: 134,361,039 N920H probably damaging Het
Hfm1 C T 5: 106,847,709 E1279K probably benign Het
Il31ra C T 13: 112,551,942 D34N possibly damaging Het
Klhl3 T A 13: 58,018,887 I430F possibly damaging Het
Lexm G T 4: 106,611,514 H271N possibly damaging Het
Mfhas1 A G 8: 35,589,265 Y298C probably damaging Het
Muc20 A T 16: 32,793,489 M506K possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Naip1 T A 13: 100,444,649 D30V probably damaging Het
Nol9 A G 4: 152,051,761 N430S probably benign Het
Olfr907 T C 9: 38,499,023 M118T probably damaging Het
Palm3 A G 8: 84,029,548 E563G probably damaging Het
Pcdhga4 A G 18: 37,687,317 S640G possibly damaging Het
Pi4ka A G 16: 17,350,830 F679L probably damaging Het
Polr3c A G 3: 96,727,343 probably null Het
Ptdss2 T A 7: 141,153,012 I236N probably damaging Het
Rapgef1 A G 2: 29,730,609 Y879C possibly damaging Het
Shc3 T C 13: 51,442,773 T405A probably benign Het
Smtnl2 G T 11: 72,403,033 S232R probably benign Het
Taar8a G A 10: 24,076,893 A132T probably damaging Het
Tex47 T C 5: 7,305,212 I131T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r63 A G 7: 5,802,914 S240P probably benign Het
Vmn2r84 A G 10: 130,389,241 W467R possibly damaging Het
Vmn2r-ps130 T C 17: 23,063,766 V140A probably benign Het
Zscan12 T C 13: 21,369,158 L384P probably damaging Het
Other mutations in Gtf3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gtf3c1 APN 7 125644258 missense probably benign 0.15
IGL00535:Gtf3c1 APN 7 125644153 missense probably benign 0.00
IGL00778:Gtf3c1 APN 7 125667374 missense probably damaging 1.00
IGL00832:Gtf3c1 APN 7 125654460 splice site probably benign
IGL01383:Gtf3c1 APN 7 125699500 missense probably damaging 1.00
IGL01472:Gtf3c1 APN 7 125651054 splice site probably benign
IGL01743:Gtf3c1 APN 7 125663415 missense probably damaging 1.00
IGL01867:Gtf3c1 APN 7 125662376 missense probably benign 0.44
IGL02016:Gtf3c1 APN 7 125668039 missense probably damaging 1.00
IGL02096:Gtf3c1 APN 7 125659112 missense probably damaging 0.98
IGL02121:Gtf3c1 APN 7 125646731 nonsense probably null
IGL02226:Gtf3c1 APN 7 125667990 splice site probably null
IGL02376:Gtf3c1 APN 7 125668996 missense probably benign 0.41
IGL02581:Gtf3c1 APN 7 125646515 missense possibly damaging 0.80
IGL02750:Gtf3c1 APN 7 125676512 missense probably damaging 1.00
IGL03063:Gtf3c1 APN 7 125646503 missense possibly damaging 0.72
IGL03167:Gtf3c1 APN 7 125670580 critical splice acceptor site probably null
Godiva UTSW 7 125645534 missense possibly damaging 0.86
R0052:Gtf3c1 UTSW 7 125667971 intron probably null
R0266:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0378:Gtf3c1 UTSW 7 125647614 nonsense probably null
R0387:Gtf3c1 UTSW 7 125681104 missense probably damaging 1.00
R0426:Gtf3c1 UTSW 7 125663016 nonsense probably null
R0458:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0613:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0634:Gtf3c1 UTSW 7 125657477 unclassified probably benign
R0658:Gtf3c1 UTSW 7 125698962 missense probably damaging 1.00
R0904:Gtf3c1 UTSW 7 125668842 splice site probably benign
R1051:Gtf3c1 UTSW 7 125707649 missense probably damaging 1.00
R1481:Gtf3c1 UTSW 7 125693138 critical splice donor site probably null
R1590:Gtf3c1 UTSW 7 125676661 missense possibly damaging 0.90
R1782:Gtf3c1 UTSW 7 125667074 missense probably damaging 1.00
R1981:Gtf3c1 UTSW 7 125644272 missense possibly damaging 0.96
R2513:Gtf3c1 UTSW 7 125681173 missense probably benign 0.01
R2697:Gtf3c1 UTSW 7 125643954 missense probably damaging 0.98
R3963:Gtf3c1 UTSW 7 125693225 unclassified probably null
R4125:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4127:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4646:Gtf3c1 UTSW 7 125659094 missense possibly damaging 0.66
R4653:Gtf3c1 UTSW 7 125674100 missense probably benign 0.23
R4668:Gtf3c1 UTSW 7 125667338 missense probably damaging 1.00
R4803:Gtf3c1 UTSW 7 125663540 missense probably damaging 1.00
R5138:Gtf3c1 UTSW 7 125647492 missense probably benign 0.05
R5149:Gtf3c1 UTSW 7 125668037 missense probably damaging 0.99
R5286:Gtf3c1 UTSW 7 125663408 missense possibly damaging 0.79
R5437:Gtf3c1 UTSW 7 125667368 missense probably damaging 1.00
R5493:Gtf3c1 UTSW 7 125670544 missense probably damaging 1.00
R5610:Gtf3c1 UTSW 7 125703945 missense possibly damaging 0.94
R5656:Gtf3c1 UTSW 7 125662654 missense probably benign 0.27
R5754:Gtf3c1 UTSW 7 125644065 missense possibly damaging 0.86
R5969:Gtf3c1 UTSW 7 125645676 missense possibly damaging 0.91
R6009:Gtf3c1 UTSW 7 125647430 missense possibly damaging 0.66
R6223:Gtf3c1 UTSW 7 125676625 missense probably benign 0.01
R6628:Gtf3c1 UTSW 7 125668074 missense probably benign 0.04
R6774:Gtf3c1 UTSW 7 125641621 missense possibly damaging 0.93
R6781:Gtf3c1 UTSW 7 125659197 nonsense probably null
R6978:Gtf3c1 UTSW 7 125645534 missense possibly damaging 0.86
R7078:Gtf3c1 UTSW 7 125645742 missense possibly damaging 0.95
R7096:Gtf3c1 UTSW 7 125696559 critical splice acceptor site probably null
R7146:Gtf3c1 UTSW 7 125672821 missense possibly damaging 0.48
R7330:Gtf3c1 UTSW 7 125703883 missense probably benign 0.36
R7345:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
R7480:Gtf3c1 UTSW 7 125642541 missense probably benign 0.22
R7490:Gtf3c1 UTSW 7 125647491 missense probably damaging 0.98
R7555:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
X0065:Gtf3c1 UTSW 7 125641690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCAGCATCAGTCTCAGG -3'
(R):5'- GCCATAGGTATAGAAAGAGCCC -3'

Sequencing Primer
(F):5'- AGCATCAGTCTCAGGGCAGTG -3'
(R):5'- AAATAGGCCCGTGCAGCTTG -3'
Posted On2018-06-22