Incidental Mutation 'R6580:Palm3'
ID524088
Institutional Source Beutler Lab
Gene Symbol Palm3
Ensembl Gene ENSMUSG00000047986
Gene Nameparalemmin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6580 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84021471-84030295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84029548 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 563 (E563G)
Ref Sequence ENSEMBL: ENSMUSP00000051396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000055077]
Predicted Effect probably benign
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000055077
AA Change: E563G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051396
Gene: ENSMUSG00000047986
AA Change: E563G

DomainStartEndE-ValueType
coiled coil region 19 64 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
coiled coil region 90 116 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
low complexity region 248 261 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
low complexity region 399 416 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 707 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210245
Meta Mutation Damage Score 0.1259 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,625 R525H probably benign Het
1700007K13Rik A G 2: 28,466,050 W74R probably damaging Het
Acox3 T A 5: 35,608,403 L600Q probably damaging Het
Ankrd49 A G 9: 14,781,398 S157P probably damaging Het
Ccdc141 A G 2: 77,011,755 F1444S possibly damaging Het
Defb28 C T 2: 152,518,295 S10L possibly damaging Het
Epha6 T G 16: 59,682,616 N976T probably damaging Het
Gm45861 A G 8: 27,544,951 K976E unknown Het
Gtf2ird1 T G 5: 134,361,039 N920H probably damaging Het
Gtf3c1 A T 7: 125,644,347 M1695K probably benign Het
Hfm1 C T 5: 106,847,709 E1279K probably benign Het
Il31ra C T 13: 112,551,942 D34N possibly damaging Het
Klhl3 T A 13: 58,018,887 I430F possibly damaging Het
Lexm G T 4: 106,611,514 H271N possibly damaging Het
Mfhas1 A G 8: 35,589,265 Y298C probably damaging Het
Muc20 A T 16: 32,793,489 M506K possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Naip1 T A 13: 100,444,649 D30V probably damaging Het
Nol9 A G 4: 152,051,761 N430S probably benign Het
Olfr907 T C 9: 38,499,023 M118T probably damaging Het
Pcdhga4 A G 18: 37,687,317 S640G possibly damaging Het
Pi4ka A G 16: 17,350,830 F679L probably damaging Het
Polr3c A G 3: 96,727,343 probably null Het
Ptdss2 T A 7: 141,153,012 I236N probably damaging Het
Rapgef1 A G 2: 29,730,609 Y879C possibly damaging Het
Shc3 T C 13: 51,442,773 T405A probably benign Het
Smtnl2 G T 11: 72,403,033 S232R probably benign Het
Taar8a G A 10: 24,076,893 A132T probably damaging Het
Tex47 T C 5: 7,305,212 I131T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r63 A G 7: 5,802,914 S240P probably benign Het
Vmn2r84 A G 10: 130,389,241 W467R possibly damaging Het
Vmn2r-ps130 T C 17: 23,063,766 V140A probably benign Het
Zscan12 T C 13: 21,369,158 L384P probably damaging Het
Other mutations in Palm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Palm3 APN 8 84029445 missense possibly damaging 0.90
IGL02634:Palm3 APN 8 84028865 missense probably damaging 0.99
IGL02710:Palm3 APN 8 84028312 missense possibly damaging 0.75
R0277:Palm3 UTSW 8 84028720 missense probably damaging 1.00
R0323:Palm3 UTSW 8 84028720 missense probably damaging 1.00
R0422:Palm3 UTSW 8 84028863 missense possibly damaging 0.94
R0507:Palm3 UTSW 8 84028329 missense probably benign 0.00
R0835:Palm3 UTSW 8 84028147 missense probably benign
R1037:Palm3 UTSW 8 84029272 missense probably benign
R1618:Palm3 UTSW 8 84029662 missense possibly damaging 0.92
R1621:Palm3 UTSW 8 84030022 missense possibly damaging 0.93
R1797:Palm3 UTSW 8 84028803 missense probably benign 0.00
R1989:Palm3 UTSW 8 84030022 missense possibly damaging 0.93
R3618:Palm3 UTSW 8 84029344 missense probably benign 0.00
R3619:Palm3 UTSW 8 84029344 missense probably benign 0.00
R4495:Palm3 UTSW 8 84026866 missense probably damaging 1.00
R4588:Palm3 UTSW 8 84029386 missense probably benign 0.20
R4687:Palm3 UTSW 8 84029935 missense probably benign 0.00
R4948:Palm3 UTSW 8 84027079 nonsense probably null
R5265:Palm3 UTSW 8 84021530 critical splice donor site probably null
R5951:Palm3 UTSW 8 84029420 missense probably benign 0.02
R7237:Palm3 UTSW 8 84029488 missense probably benign 0.00
R7562:Palm3 UTSW 8 84021507 missense possibly damaging 0.87
R7676:Palm3 UTSW 8 84029445 missense possibly damaging 0.90
R7923:Palm3 UTSW 8 84029461 missense probably benign
R8118:Palm3 UTSW 8 84029809 missense probably damaging 1.00
R8680:Palm3 UTSW 8 84029875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAGAAGCCATTGGTGACAG -3'
(R):5'- ACAAACAGTGGCTCCTGGTG -3'

Sequencing Primer
(F):5'- GAAGTGAGATGCCATTGG -3'
(R):5'- TCCTGGTGGGCTGGCATC -3'
Posted On2018-06-22