Mutagenetix > Incidental Mutations

Incidental Mutation 'R6616:Mroh2b'

524091

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R6616 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 4953282 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 1528 (I1528L)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

Predicted Effect

probably benign
Transcript: ENSMUST00000045736
AA Change: I1528L

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: I1528L

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226849

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228458

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	A	T	17: 24,384,535	H567L	probably damaging	Het
Adck1	T	A	12: 88,461,188	M525K	unknown	Het
Alpi	T	C	1: 87,101,114	I74V	possibly damaging	Het
Creb5	A	C	6: 53,685,310	Q197H	possibly damaging	Het
Cyp2b13	A	G	7: 26,085,881	K225R	probably benign	Het
Dock1	G	A	7: 135,108,492	E1143K	possibly damaging	Het
Eef2kmt	T	A	16: 5,247,482	D287V	probably damaging	Het
Eif2ak4	T	A	2: 118,454,845	Y1046*	probably null	Het
Fbxw10	T	A	11: 62,853,024	M252K	probably benign	Het
Fnip2	A	C	3: 79,480,882	H847Q	probably benign	Het
Frmd3	A	T	4: 74,187,488	D457V	probably damaging	Het
Gm13941	T	G	2: 111,101,175	E37D	unknown	Het
Gm8251	C	A	1: 44,061,474	V155L	possibly damaging	Het
Grin1	T	A	2: 25,292,110	I870F	possibly damaging	Het
Grin2b	A	C	6: 135,732,551	D1332E	probably benign	Het
Gtpbp4	G	A	13: 8,989,105	T201I	possibly damaging	Het
Heatr4	A	G	12: 83,980,130	C118R	probably benign	Het
Hltf	T	A	3: 20,109,487		probably null	Het
Hmcn1	C	T	1: 150,723,257		probably null	Het
Hpd	A	T	5: 123,172,060	L367Q	probably damaging	Het
Htr1b	A	G	9: 81,632,434	I40T	probably benign	Het
Il16	A	G	7: 83,646,476	S464P	probably benign	Het
Lrp1b	T	A	2: 40,699,631	D75V	unknown	Het
Map3k4	A	T	17: 12,271,344	L400Q	probably damaging	Het
Mcts2	T	A	2: 152,687,662	I131N	possibly damaging	Het
Muc4	A	C	16: 32,782,008	D3467A	possibly damaging	Het
Mypn	A	T	10: 63,169,312	C339S	probably damaging	Het
Ncoa5	A	T	2: 165,010,563	Y130*	probably null	Het
Olfr1381	T	A	11: 49,552,041	V98E	probably damaging	Het
Olfr743	T	A	14: 50,533,907	I165N	probably benign	Het
Pcdha4	A	G	18: 36,953,900	T379A	probably benign	Het
Pkp4	C	G	2: 59,350,552	Y720*	probably null	Het
Prl5a1	C	T	13: 28,149,856	T114I	probably benign	Het
Rnd3	A	G	2: 51,134,157	S137P	probably damaging	Het
Rtel1	G	A	2: 181,352,786	E680K	possibly damaging	Het
Sbsn	T	A	7: 30,753,279	V573D	possibly damaging	Het
Scaf8	A	T	17: 3,168,055	L233F	unknown	Het
Sec23a	A	T	12: 58,997,155	I241K	possibly damaging	Het
Secisbp2l	A	T	2: 125,768,226	S258T	probably damaging	Het
Skint4	A	G	4: 112,118,230	H121R	possibly damaging	Het
Sptbn1	T	A	11: 30,124,030	E1346D	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Stpg4	A	G	17: 87,422,696	Y74H	probably damaging	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tmc4	A	G	7: 3,671,058	V374A	possibly damaging	Het
Unc45b	G	A	11: 82,911,819	R47Q	probably damaging	Het
Xirp1	A	G	9: 120,019,014	S268P	probably damaging	Het
Zfp990	A	T	4: 145,537,145	I238L	probably benign	Het
Zswim5	A	G	4: 116,986,741	D992G	possibly damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	intron	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAAACACTTTCCACTCAGG -3'
(R):5'- TCATAGAAATTCTAGCGTCTAGGC -3'

Sequencing Primer
(F):5'- ACTCAGGTTGCTCAGCAC -3'
(R):5'- CAACTTCAGAAAATAACGTGGATGC -3'

Posted On

2018-06-22