Incidental Mutation 'R6616:Eef2kmt'
ID524093
Institutional Source Beutler Lab
Gene Symbol Eef2kmt
Ensembl Gene ENSMUSG00000022544
Gene Nameeukaryotic elongation factor 2 lysine methyltransferase
Synonyms5730409G15Rik, Fam86
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location5244152-5255983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5247482 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 287 (D287V)
Ref Sequence ENSEMBL: ENSMUSP00000068003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049207] [ENSMUST00000064635] [ENSMUST00000100196] [ENSMUST00000139584]
Predicted Effect probably benign
Transcript: ENSMUST00000049207
SMART Domains Protein: ENSMUSP00000046534
Gene: ENSMUSG00000039427

DomainStartEndE-ValueType
transmembrane domain 5 23 N/A INTRINSIC
Pfam:Glycos_transf_1 246 422 8e-14 PFAM
Pfam:Glyco_trans_1_4 250 400 1.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064635
AA Change: D287V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068003
Gene: ENSMUSG00000022544
AA Change: D287V

DomainStartEndE-ValueType
Pfam:FAM86 6 99 2.7e-42 PFAM
Pfam:Methyltransf_16 119 299 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100196
SMART Domains Protein: ENSMUSP00000097770
Gene: ENSMUSG00000039427

DomainStartEndE-ValueType
transmembrane domain 5 23 N/A INTRINSIC
Pfam:Glycos_transf_1 270 447 2.4e-13 PFAM
Pfam:Glyco_trans_1_4 276 426 1.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132225
Predicted Effect probably damaging
Transcript: ENSMUST00000139584
AA Change: D287V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123572
Gene: ENSMUSG00000022544
AA Change: D287V

DomainStartEndE-ValueType
Pfam:FAM86 1 100 2.7e-62 PFAM
Pfam:Methyltransf_16 119 299 2e-23 PFAM
low complexity region 311 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230238
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Scaf8 A T 17: 3,168,055 L233F unknown Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Eef2kmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2259:Eef2kmt UTSW 16 5245308 missense probably benign 0.30
R2267:Eef2kmt UTSW 16 5255940 start gained probably benign
R4036:Eef2kmt UTSW 16 5245271 missense probably damaging 0.98
R4037:Eef2kmt UTSW 16 5245271 missense probably damaging 0.98
R4038:Eef2kmt UTSW 16 5245271 missense probably damaging 0.98
R4088:Eef2kmt UTSW 16 5253035 missense probably damaging 1.00
R4836:Eef2kmt UTSW 16 5249003 missense probably damaging 0.98
R4974:Eef2kmt UTSW 16 5249012 missense probably benign 0.14
R5023:Eef2kmt UTSW 16 5247599 missense probably damaging 1.00
R5282:Eef2kmt UTSW 16 5245358 missense probably benign 0.27
R5444:Eef2kmt UTSW 16 5249095 intron probably benign
R5635:Eef2kmt UTSW 16 5249029 missense probably damaging 0.99
R7320:Eef2kmt UTSW 16 5250509 missense possibly damaging 0.93
R7343:Eef2kmt UTSW 16 5247435 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGCCCAAAACAATGGCAG -3'
(R):5'- TCTTAATACTGCAGCTCCCAAG -3'

Sequencing Primer
(F):5'- AGCCAACTGCCCATTGC -3'
(R):5'- TGCCCCCAGAGTGAGAC -3'
Posted On2018-06-22