Incidental Mutation 'R6580:Taar8a'
ID524094
Institutional Source Beutler Lab
Gene Symbol Taar8a
Ensembl Gene ENSMUSG00000096442
Gene Nametrace amine-associated receptor 8A
SynonymsLOC215859
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6580 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location24076500-24077534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24076893 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 132 (A132T)
Ref Sequence ENSEMBL: ENSMUSP00000062719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051133]
Predicted Effect probably damaging
Transcript: ENSMUST00000051133
AA Change: A132T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062719
Gene: ENSMUSG00000096442
AA Change: A132T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 40 244 3.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 42 327 7.1e-15 PFAM
Pfam:7tm_1 48 312 9.1e-58 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (32/33)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,066,625 R525H probably benign Het
1700007K13Rik A G 2: 28,466,050 W74R probably damaging Het
Acox3 T A 5: 35,608,403 L600Q probably damaging Het
Ankrd49 A G 9: 14,781,398 S157P probably damaging Het
Ccdc141 A G 2: 77,011,755 F1444S possibly damaging Het
Defb28 C T 2: 152,518,295 S10L possibly damaging Het
Epha6 T G 16: 59,682,616 N976T probably damaging Het
Gm45861 A G 8: 27,544,951 K976E unknown Het
Gtf2ird1 T G 5: 134,361,039 N920H probably damaging Het
Gtf3c1 A T 7: 125,644,347 M1695K probably benign Het
Hfm1 C T 5: 106,847,709 E1279K probably benign Het
Il31ra C T 13: 112,551,942 D34N possibly damaging Het
Klhl3 T A 13: 58,018,887 I430F possibly damaging Het
Lexm G T 4: 106,611,514 H271N possibly damaging Het
Mfhas1 A G 8: 35,589,265 Y298C probably damaging Het
Muc20 A T 16: 32,793,489 M506K possibly damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Naip1 T A 13: 100,444,649 D30V probably damaging Het
Nol9 A G 4: 152,051,761 N430S probably benign Het
Olfr907 T C 9: 38,499,023 M118T probably damaging Het
Palm3 A G 8: 84,029,548 E563G probably damaging Het
Pcdhga4 A G 18: 37,687,317 S640G possibly damaging Het
Pi4ka A G 16: 17,350,830 F679L probably damaging Het
Polr3c A G 3: 96,727,343 probably null Het
Ptdss2 T A 7: 141,153,012 I236N probably damaging Het
Rapgef1 A G 2: 29,730,609 Y879C possibly damaging Het
Shc3 T C 13: 51,442,773 T405A probably benign Het
Smtnl2 G T 11: 72,403,033 S232R probably benign Het
Tex47 T C 5: 7,305,212 I131T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r63 A G 7: 5,802,914 S240P probably benign Het
Vmn2r84 A G 10: 130,389,241 W467R possibly damaging Het
Vmn2r-ps130 T C 17: 23,063,766 V140A probably benign Het
Zscan12 T C 13: 21,369,158 L384P probably damaging Het
Other mutations in Taar8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Taar8a APN 10 24076861 missense probably damaging 1.00
IGL01546:Taar8a APN 10 24076915 missense possibly damaging 0.95
IGL01597:Taar8a APN 10 24076858 missense possibly damaging 0.96
IGL02387:Taar8a APN 10 24077362 missense possibly damaging 0.93
IGL02815:Taar8a APN 10 24077380 missense probably benign 0.02
R0762:Taar8a UTSW 10 24077077 missense probably benign 0.34
R1690:Taar8a UTSW 10 24076915 missense probably damaging 1.00
R2891:Taar8a UTSW 10 24077130 missense probably benign 0.02
R3889:Taar8a UTSW 10 24077025 missense probably benign 0.00
R3962:Taar8a UTSW 10 24077156 missense probably damaging 0.99
R4090:Taar8a UTSW 10 24077164 missense probably damaging 0.96
R6605:Taar8a UTSW 10 24076776 missense possibly damaging 0.88
R7422:Taar8a UTSW 10 24076864 missense probably damaging 1.00
R7571:Taar8a UTSW 10 24077408 nonsense probably null
R8265:Taar8a UTSW 10 24076941 missense probably damaging 1.00
X0022:Taar8a UTSW 10 24077508 missense possibly damaging 0.93
X0062:Taar8a UTSW 10 24077381 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCAAGCAGCTGCACTCTC -3'
(R):5'- GATAACAATTTGGCAGCCCC -3'

Sequencing Primer
(F):5'- CTCTCTGGCCAGTGCTGAC -3'
(R):5'- TGGCAGCCCCCTACACAATTTAG -3'
Posted On2018-06-22