Incidental Mutation 'R6616:Scaf8'
ID524097
Institutional Source Beutler Lab
Gene Symbol Scaf8
Ensembl Gene ENSMUSG00000046201
Gene NameSR-related CTD-associated factor 8
SynonymsRbm16, A630086M08Rik, A930036P18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R6616 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location3114972-3198859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3168055 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 233 (L233F)
Ref Sequence ENSEMBL: ENSMUSP00000076024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076734]
Predicted Effect unknown
Transcript: ENSMUST00000076734
AA Change: L233F
SMART Domains Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: L233F

DomainStartEndE-ValueType
RPR 6 136 1.26e-42 SMART
low complexity region 157 171 N/A INTRINSIC
low complexity region 193 223 N/A INTRINSIC
low complexity region 232 251 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 397 462 N/A INTRINSIC
RRM 478 547 9.2e-14 SMART
low complexity region 644 677 N/A INTRINSIC
low complexity region 685 712 N/A INTRINSIC
low complexity region 857 883 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
low complexity region 962 971 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
internal_repeat_1 1048 1064 2e-5 PROSPERO
internal_repeat_1 1059 1075 2e-5 PROSPERO
low complexity region 1146 1168 N/A INTRINSIC
low complexity region 1249 1268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,384,535 H567L probably damaging Het
Adck1 T A 12: 88,461,188 M525K unknown Het
Alpi T C 1: 87,101,114 I74V possibly damaging Het
Creb5 A C 6: 53,685,310 Q197H possibly damaging Het
Cyp2b13 A G 7: 26,085,881 K225R probably benign Het
Dock1 G A 7: 135,108,492 E1143K possibly damaging Het
Eef2kmt T A 16: 5,247,482 D287V probably damaging Het
Eif2ak4 T A 2: 118,454,845 Y1046* probably null Het
Fbxw10 T A 11: 62,853,024 M252K probably benign Het
Fnip2 A C 3: 79,480,882 H847Q probably benign Het
Frmd3 A T 4: 74,187,488 D457V probably damaging Het
Gm13941 T G 2: 111,101,175 E37D unknown Het
Gm8251 C A 1: 44,061,474 V155L possibly damaging Het
Grin1 T A 2: 25,292,110 I870F possibly damaging Het
Grin2b A C 6: 135,732,551 D1332E probably benign Het
Gtpbp4 G A 13: 8,989,105 T201I possibly damaging Het
Heatr4 A G 12: 83,980,130 C118R probably benign Het
Hltf T A 3: 20,109,487 probably null Het
Hmcn1 C T 1: 150,723,257 probably null Het
Hpd A T 5: 123,172,060 L367Q probably damaging Het
Htr1b A G 9: 81,632,434 I40T probably benign Het
Il16 A G 7: 83,646,476 S464P probably benign Het
Lrp1b T A 2: 40,699,631 D75V unknown Het
Map3k4 A T 17: 12,271,344 L400Q probably damaging Het
Mcts2 T A 2: 152,687,662 I131N possibly damaging Het
Mroh2b A C 15: 4,953,282 I1528L probably benign Het
Muc4 A C 16: 32,782,008 D3467A possibly damaging Het
Mypn A T 10: 63,169,312 C339S probably damaging Het
Ncoa5 A T 2: 165,010,563 Y130* probably null Het
Olfr1381 T A 11: 49,552,041 V98E probably damaging Het
Olfr743 T A 14: 50,533,907 I165N probably benign Het
Pcdha4 A G 18: 36,953,900 T379A probably benign Het
Pkp4 C G 2: 59,350,552 Y720* probably null Het
Prl5a1 C T 13: 28,149,856 T114I probably benign Het
Rnd3 A G 2: 51,134,157 S137P probably damaging Het
Rtel1 G A 2: 181,352,786 E680K possibly damaging Het
Sbsn T A 7: 30,753,279 V573D possibly damaging Het
Sec23a A T 12: 58,997,155 I241K possibly damaging Het
Secisbp2l A T 2: 125,768,226 S258T probably damaging Het
Skint4 A G 4: 112,118,230 H121R possibly damaging Het
Sptbn1 T A 11: 30,124,030 E1346D probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stpg4 A G 17: 87,422,696 Y74H probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmc4 A G 7: 3,671,058 V374A possibly damaging Het
Unc45b G A 11: 82,911,819 R47Q probably damaging Het
Xirp1 A G 9: 120,019,014 S268P probably damaging Het
Zfp990 A T 4: 145,537,145 I238L probably benign Het
Zswim5 A G 4: 116,986,741 D992G possibly damaging Het
Other mutations in Scaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Scaf8 APN 17 3171134 missense unknown
IGL00956:Scaf8 APN 17 3171147 missense unknown
IGL01610:Scaf8 APN 17 3195849 missense probably damaging 1.00
IGL01967:Scaf8 APN 17 3196938 missense possibly damaging 0.91
IGL02005:Scaf8 APN 17 3185870 missense probably damaging 1.00
IGL03037:Scaf8 APN 17 3190221 missense probably damaging 0.99
BB004:Scaf8 UTSW 17 3159220 missense unknown
BB014:Scaf8 UTSW 17 3159220 missense unknown
R0320:Scaf8 UTSW 17 3178255 missense unknown
R0789:Scaf8 UTSW 17 3196837 missense possibly damaging 0.94
R0850:Scaf8 UTSW 17 3195774 splice site probably null
R0919:Scaf8 UTSW 17 3197120 missense probably damaging 1.00
R1488:Scaf8 UTSW 17 3197597 missense probably damaging 0.97
R1544:Scaf8 UTSW 17 3145154 missense probably damaging 0.96
R1928:Scaf8 UTSW 17 3168077 missense unknown
R1972:Scaf8 UTSW 17 3169371 missense unknown
R2156:Scaf8 UTSW 17 3164132 splice site probably null
R2164:Scaf8 UTSW 17 3197210 missense probably damaging 1.00
R2680:Scaf8 UTSW 17 3197591 missense possibly damaging 0.95
R3794:Scaf8 UTSW 17 3190249 missense probably damaging 1.00
R4368:Scaf8 UTSW 17 3171195 missense unknown
R4673:Scaf8 UTSW 17 3197985 missense probably benign 0.04
R4694:Scaf8 UTSW 17 3197404 missense probably damaging 1.00
R4716:Scaf8 UTSW 17 3177123 missense unknown
R4852:Scaf8 UTSW 17 3178219 missense unknown
R5036:Scaf8 UTSW 17 3164262 unclassified probably benign
R5193:Scaf8 UTSW 17 3190165 missense probably benign 0.02
R5429:Scaf8 UTSW 17 3197110 missense probably benign 0.14
R5816:Scaf8 UTSW 17 3177713 missense unknown
R6050:Scaf8 UTSW 17 3168108 missense unknown
R6493:Scaf8 UTSW 17 3171119 missense unknown
R7065:Scaf8 UTSW 17 3159211 missense probably damaging 1.00
R7112:Scaf8 UTSW 17 3163029 missense unknown
R7141:Scaf8 UTSW 17 3159182 missense unknown
R7198:Scaf8 UTSW 17 3163098 missense unknown
R7265:Scaf8 UTSW 17 3177625 missense unknown
R7592:Scaf8 UTSW 17 3171222 critical splice donor site probably null
R7711:Scaf8 UTSW 17 3187634 missense probably damaging 0.97
R7813:Scaf8 UTSW 17 3197274 missense probably damaging 1.00
R7867:Scaf8 UTSW 17 3177719 missense unknown
R7927:Scaf8 UTSW 17 3159220 missense unknown
R7937:Scaf8 UTSW 17 3197207 missense probably damaging 0.99
R7958:Scaf8 UTSW 17 3171122 missense unknown
R7960:Scaf8 UTSW 17 3171122 missense unknown
R8024:Scaf8 UTSW 17 3159293 missense unknown
R8118:Scaf8 UTSW 17 3164183 missense unknown
R8285:Scaf8 UTSW 17 3177129 missense unknown
R8303:Scaf8 UTSW 17 3148552 missense unknown
R8365:Scaf8 UTSW 17 3195966 missense possibly damaging 0.67
Z1088:Scaf8 UTSW 17 3162983 unclassified probably benign
Z1177:Scaf8 UTSW 17 3162994 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCTGAAGGATGATAAAGTTTGTCA -3'
(R):5'- AGTAGCAAACACACAAGTCTGT -3'

Sequencing Primer
(F):5'- ATCATCTGTAATGGGATCCGATGCC -3'
(R):5'- GCAAACACACAAGTCTGTAATAAAAC -3'
Posted On2018-06-22