Mutagenetix > Incidental Mutations

Incidental Mutation 'R6580:Epha6'

524115

Institutional Source

Beutler Lab

Gene Symbol

Epha6

Ensembl Gene

ENSMUSG00000055540

Gene Name

Eph receptor A6

Synonyms

m-ehk2, Hek12, Ehk2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6580 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59653483-60605531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 59682616 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 976 (N976T)

Ref Sequence

ENSEMBL: ENSMUSP00000066734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068860]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000068860
AA Change: N976T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: N976T

Domain	Start	End	E-Value	Type
low complexity region	4	37	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
EPH_lbd	128	301	5.95e-125	SMART
Pfam:GCC2_GCC3	361	406	1.6e-8	PFAM
FN3	426	518	5.83e-3	SMART
FN3	537	618	2.19e-7	SMART
Pfam:EphA2_TM	644	722	1.8e-22	PFAM
TyrKc	725	1024	3.66e-122	SMART
SAM	1052	1119	1.24e-22	SMART

Meta Mutation Damage Score

0.1514

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

97% (32/33)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	A	3: 138,066,625	R525H	probably benign	Het
1700007K13Rik	A	G	2: 28,466,050	W74R	probably damaging	Het
Acox3	T	A	5: 35,608,403	L600Q	probably damaging	Het
Ankrd49	A	G	9: 14,781,398	S157P	probably damaging	Het
Ccdc141	A	G	2: 77,011,755	F1444S	possibly damaging	Het
Defb28	C	T	2: 152,518,295	S10L	possibly damaging	Het
Gm45861	A	G	8: 27,544,951	K976E	unknown	Het
Gtf2ird1	T	G	5: 134,361,039	N920H	probably damaging	Het
Gtf3c1	A	T	7: 125,644,347	M1695K	probably benign	Het
Hfm1	C	T	5: 106,847,709	E1279K	probably benign	Het
Il31ra	C	T	13: 112,551,942	D34N	possibly damaging	Het
Klhl3	T	A	13: 58,018,887	I430F	possibly damaging	Het
Lexm	G	T	4: 106,611,514	H271N	possibly damaging	Het
Mfhas1	A	G	8: 35,589,265	Y298C	probably damaging	Het
Muc20	A	T	16: 32,793,489	M506K	possibly damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Naip1	T	A	13: 100,444,649	D30V	probably damaging	Het
Nol9	A	G	4: 152,051,761	N430S	probably benign	Het
Olfr907	T	C	9: 38,499,023	M118T	probably damaging	Het
Palm3	A	G	8: 84,029,548	E563G	probably damaging	Het
Pcdhga4	A	G	18: 37,687,317	S640G	possibly damaging	Het
Pi4ka	A	G	16: 17,350,830	F679L	probably damaging	Het
Polr3c	A	G	3: 96,727,343		probably null	Het
Ptdss2	T	A	7: 141,153,012	I236N	probably damaging	Het
Rapgef1	A	G	2: 29,730,609	Y879C	possibly damaging	Het
Shc3	T	C	13: 51,442,773	T405A	probably benign	Het
Smtnl2	G	T	11: 72,403,033	S232R	probably benign	Het
Taar8a	G	A	10: 24,076,893	A132T	probably damaging	Het
Tex47	T	C	5: 7,305,212	I131T	probably damaging	Het
Tiam2	CGGG	CGGGG	17: 3,414,622		probably null	Het
Vmn1r63	A	G	7: 5,802,914	S240P	probably benign	Het
Vmn2r84	A	G	10: 130,389,241	W467R	possibly damaging	Het
Vmn2r-ps130	T	C	17: 23,063,766	V140A	probably benign	Het
Zscan12	T	C	13: 21,369,158	L384P	probably damaging	Het

Other mutations in Epha6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Epha6	APN	16	59915962	missense	probably damaging	1.00
IGL00849:Epha6	APN	16	60425111	missense	possibly damaging	0.89
IGL00898:Epha6	APN	16	59775541	critical splice donor site	probably null
IGL01353:Epha6	APN	16	60424895	missense	probably damaging	1.00
IGL01409:Epha6	APN	16	59655737	nonsense	probably null
IGL01577:Epha6	APN	16	59956926	missense	possibly damaging	0.57
IGL01653:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01654:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01655:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01657:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01663:Epha6	APN	16	59775644	missense	probably damaging	1.00
IGL01899:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL02272:Epha6	APN	16	59818937	missense	probably damaging	1.00
IGL03265:Epha6	APN	16	60060231	splice site	probably benign
IGL03333:Epha6	APN	16	59682688	missense	probably damaging	1.00
rauwulfia	UTSW	16	59682616	missense	probably damaging	1.00
PIT4377001:Epha6	UTSW	16	60205552	missense	probably damaging	0.98
R0505:Epha6	UTSW	16	60205732	missense	possibly damaging	0.89
R1593:Epha6	UTSW	16	60424904	missense	probably damaging	1.00
R1764:Epha6	UTSW	16	59775728	missense	probably null	1.00
R1836:Epha6	UTSW	16	60205745	missense	probably damaging	1.00
R2061:Epha6	UTSW	16	59655797	missense	probably damaging	1.00
R2125:Epha6	UTSW	16	59682688	missense	probably damaging	1.00
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R3760:Epha6	UTSW	16	60220984	missense	possibly damaging	0.70
R4305:Epha6	UTSW	16	60526520	splice site	probably null
R4613:Epha6	UTSW	16	59666597	missense	possibly damaging	0.80
R4818:Epha6	UTSW	16	59654063	missense	probably damaging	0.99
R4832:Epha6	UTSW	16	59960413	missense	probably damaging	0.98
R4895:Epha6	UTSW	16	59666555	missense	probably benign	0.08
R5014:Epha6	UTSW	16	59666579	missense	probably benign	0.00
R5316:Epha6	UTSW	16	59954720	missense	probably damaging	0.99
R5403:Epha6	UTSW	16	59775570	missense	probably damaging	1.00
R5417:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5418:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5678:Epha6	UTSW	16	59818979	missense	probably damaging	1.00
R5775:Epha6	UTSW	16	59818994	missense	possibly damaging	0.92
R5808:Epha6	UTSW	16	59682742	missense	probably damaging	1.00
R6076:Epha6	UTSW	16	60205710	missense	probably damaging	1.00
R6146:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6212:Epha6	UTSW	16	60425356	missense	possibly damaging	0.77
R6242:Epha6	UTSW	16	59682662	missense	probably damaging	1.00
R6503:Epha6	UTSW	16	60205621	missense	possibly damaging	0.61
R6726:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6728:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6798:Epha6	UTSW	16	60605064	missense	possibly damaging	0.53
R6798:Epha6	UTSW	16	60605065	missense	possibly damaging	0.53
R6903:Epha6	UTSW	16	60526462	missense	probably benign	0.00
R6999:Epha6	UTSW	16	60425170	missense	possibly damaging	0.94
R7058:Epha6	UTSW	16	59682650	missense	probably damaging	1.00
R7109:Epha6	UTSW	16	59682668	missense	probably damaging	1.00
R7263:Epha6	UTSW	16	59775665	missense	probably damaging	1.00
R7296:Epha6	UTSW	16	59915838	missense	probably benign	0.00
R7343:Epha6	UTSW	16	59960430	missense	probably damaging	0.98
R7443:Epha6	UTSW	16	59775625	missense	possibly damaging	0.93
R7533:Epha6	UTSW	16	60205562	missense	probably damaging	1.00
R7602:Epha6	UTSW	16	59775568	missense	probably damaging	1.00
R7604:Epha6	UTSW	16	60205772	missense	possibly damaging	0.89
R8321:Epha6	UTSW	16	59915954	missense	probably damaging	1.00
R8414:Epha6	UTSW	16	60005667	missense	probably damaging	1.00
R8794:Epha6	UTSW	16	60205672	missense	probably benign	0.00
R8926:Epha6	UTSW	16	59839299	missense	probably benign	0.11
R9166:Epha6	UTSW	16	60604875	missense	probably benign	0.00
R9265:Epha6	UTSW	16	59655754	missense	probably damaging	1.00
R9322:Epha6	UTSW	16	60424755	missense	probably damaging	1.00
Z1188:Epha6	UTSW	16	59654090	missense	probably damaging	1.00
Z1189:Epha6	UTSW	16	59654090	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTAAGATGTGTGCCCAGC -3'
(R):5'- CCTGTGTCTTAATATACTTGGGAAC -3'

Sequencing Primer
(F):5'- ATGTGTGCCCAGCATGGAAC -3'
(R):5'- AAAGTTCTCCTCAGCCAG -3'

Posted On

2018-06-22