Incidental Mutation 'R6617:Tsc1'
ID524118
Institutional Source Beutler Lab
Gene Symbol Tsc1
Ensembl Gene ENSMUSG00000026812
Gene Nametuberous sclerosis 1
Synonymshamartin
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_022887.3; MGI: 1929183

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6617 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28641228-28691167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28686989 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1101 (D1101G)
Ref Sequence ENSEMBL: ENSMUSP00000109500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028155] [ENSMUST00000113867] [ENSMUST00000113869] [ENSMUST00000113870] [ENSMUST00000133565]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028155
AA Change: D1100G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028155
Gene: ENSMUSG00000026812
AA Change: D1100G

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113867
AA Change: D1095G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109498
Gene: ENSMUSG00000026812
AA Change: D1095G

DomainStartEndE-ValueType
Pfam:Hamartin 2 710 7.3e-279 PFAM
SCOP:d1eq1a_ 718 881 6e-11 SMART
low complexity region 969 985 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1094 1112 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113869
AA Change: D1101G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109500
Gene: ENSMUSG00000026812
AA Change: D1101G

DomainStartEndE-ValueType
Pfam:Hamartin 7 716 6e-279 PFAM
SCOP:d1eq1a_ 724 887 4e-11 SMART
low complexity region 975 991 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113870
AA Change: D1100G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109501
Gene: ENSMUSG00000026812
AA Change: D1100G

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133565
SMART Domains Protein: ENSMUSP00000120888
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 455 1.3e-198 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (39/39)
MGI Phenotype Strain: 2183900
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mutants show liver hypoplasia, open neural tube and die by embryonic day 10.5-11.5. Heterozygotes develop kidney cystadenomas and liver hemangiomas. Conditional astrocyte-specific nulls show increased astrocyte numbers and seizures. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(7) Gene trapped(31)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,490,532 I323K possibly damaging Het
Agbl4 T A 4: 110,580,135 V81D probably damaging Het
Akap13 A G 7: 75,730,363 D2147G possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Arhgef18 T C 8: 3,439,592 L308P probably damaging Het
Atad2b C A 12: 5,024,668 L1076I probably benign Het
Chp2 T C 7: 122,220,694 V59A probably benign Het
Cped1 T A 6: 22,215,547 C555* probably null Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Crispld1 G A 1: 17,728,662 M2I probably benign Het
Cul3 T C 1: 80,276,439 N540S probably damaging Het
Dll4 A G 2: 119,327,931 T134A probably benign Het
Fat2 G A 11: 55,296,105 T1305I probably benign Het
Fbxw8 A G 5: 118,142,666 probably null Het
Gm9195 A T 14: 72,431,775 L2649H probably damaging Het
Gprc5c A G 11: 114,864,105 I203V probably benign Het
Hmcn1 T C 1: 150,743,796 D1189G probably benign Het
Hnrnpl C A 7: 28,818,584 probably benign Het
Homer1 T A 13: 93,341,862 Y38N probably damaging Het
Itgb5 A G 16: 33,946,592 T707A probably benign Het
Lmbrd1 G A 1: 24,685,428 R31Q probably damaging Het
Mbtps1 G A 8: 119,538,137 P341S probably damaging Het
Mlxip A G 5: 123,442,449 probably null Het
Myh13 A T 11: 67,361,400 T1445S probably benign Het
Ncapg C T 5: 45,670,132 A37V probably benign Het
Neb A G 2: 52,207,747 F4909L probably damaging Het
Nrcam T A 12: 44,540,963 W141R probably damaging Het
Olfr424 T G 1: 174,137,248 F168C probably damaging Het
Phykpl A G 11: 51,593,954 E247G probably damaging Het
Plekhh2 A G 17: 84,566,287 I333M possibly damaging Het
Sorcs2 A G 5: 36,077,966 F69L probably damaging Het
Sspo C A 6: 48,491,046 T349K possibly damaging Het
Stap2 A G 17: 55,999,746 S276P probably benign Het
Tle1 A G 4: 72,141,280 S275P probably damaging Het
Topors G A 4: 40,261,896 Q463* probably null Het
Tyrp1 G A 4: 80,846,747 A54T probably benign Het
Vcam1 A G 3: 116,126,062 V185A possibly damaging Het
Vmn2r19 T A 6: 123,336,535 *855R probably null Het
Other mutations in Tsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tsc1 APN 2 28661611 missense probably damaging 0.98
IGL00770:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00774:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00835:Tsc1 APN 2 28672466 missense possibly damaging 0.93
IGL00971:Tsc1 APN 2 28670940 nonsense probably null
IGL01808:Tsc1 APN 2 28662507 missense probably damaging 1.00
IGL02281:Tsc1 APN 2 28663595 missense probably damaging 1.00
IGL03068:Tsc1 APN 2 28681258 missense probably damaging 1.00
Cassava UTSW 2 28671886 splice site probably null
R0077:Tsc1 UTSW 2 28678943 splice site probably benign
R0149:Tsc1 UTSW 2 28670901 missense probably damaging 0.99
R0605:Tsc1 UTSW 2 28671778 missense probably damaging 1.00
R0737:Tsc1 UTSW 2 28670930 missense possibly damaging 0.94
R1199:Tsc1 UTSW 2 28665626 missense probably damaging 1.00
R1751:Tsc1 UTSW 2 28676026 missense probably damaging 0.97
R1757:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R1807:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R2014:Tsc1 UTSW 2 28665637 splice site probably benign
R2284:Tsc1 UTSW 2 28665097 missense possibly damaging 0.85
R3786:Tsc1 UTSW 2 28687142 missense probably damaging 1.00
R4490:Tsc1 UTSW 2 28670925 missense probably damaging 0.97
R4707:Tsc1 UTSW 2 28672407 missense probably damaging 1.00
R4751:Tsc1 UTSW 2 28679081 missense probably damaging 0.96
R4794:Tsc1 UTSW 2 28661690 splice site probably null
R4906:Tsc1 UTSW 2 28675189 missense possibly damaging 0.81
R5020:Tsc1 UTSW 2 28676519 missense probably damaging 1.00
R5401:Tsc1 UTSW 2 28686908 nonsense probably null
R5708:Tsc1 UTSW 2 28665185 intron probably benign
R6435:Tsc1 UTSW 2 28676452 missense probably benign 0.08
R6469:Tsc1 UTSW 2 28671886 splice site probably null
R6502:Tsc1 UTSW 2 28665601 missense probably damaging 1.00
R7098:Tsc1 UTSW 2 28675732 missense probably benign 0.00
R7503:Tsc1 UTSW 2 28687076 missense possibly damaging 0.50
R7608:Tsc1 UTSW 2 28658736 missense probably benign 0.01
R7677:Tsc1 UTSW 2 28672817 missense probably benign 0.11
R7791:Tsc1 UTSW 2 28681948 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGGAGGTAGAGTCAC -3'
(R):5'- AGCTGTGTTCAGGATGAGTC -3'

Sequencing Primer
(F):5'- AGTGAGCTTTCCACTCCAGAG -3'
(R):5'- CAGGATGAGTCTCATTGTAGTCC -3'
Posted On2018-06-22