Incidental Mutation 'R6617:Dll4'
ID524122
Institutional Source Beutler Lab
Gene Symbol Dll4
Ensembl Gene ENSMUSG00000027314
Gene Namedelta like canonical Notch ligand 4
SynonymsDelta4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6617 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119325784-119335962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119327931 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 134 (T134A)
Ref Sequence ENSEMBL: ENSMUSP00000099575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102517]
Predicted Effect probably benign
Transcript: ENSMUST00000102517
AA Change: T134A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099575
Gene: ENSMUSG00000027314
AA Change: T134A

DomainStartEndE-ValueType
Pfam:MNNL 27 92 7.3e-21 PFAM
low complexity region 139 150 N/A INTRINSIC
DSL 156 218 1.98e-23 SMART
EGF 222 252 5.62e0 SMART
EGF 253 283 5.79e-2 SMART
EGF_CA 285 323 1.38e-8 SMART
EGF_CA 329 361 5.36e-6 SMART
EGF 366 401 4.35e-6 SMART
EGF 406 439 1.44e-6 SMART
EGF_CA 441 477 2.33e-6 SMART
EGF 484 519 9.33e-6 SMART
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156538
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, absent vascular remodeling, small hearts, and embryonic growth retardation. Heterozygous null mice display background dependent partial or complete embryonic lethality, impaired vascular remodeling, and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,490,532 I323K possibly damaging Het
Agbl4 T A 4: 110,580,135 V81D probably damaging Het
Akap13 A G 7: 75,730,363 D2147G possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Arhgef18 T C 8: 3,439,592 L308P probably damaging Het
Atad2b C A 12: 5,024,668 L1076I probably benign Het
Chp2 T C 7: 122,220,694 V59A probably benign Het
Cped1 T A 6: 22,215,547 C555* probably null Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Crispld1 G A 1: 17,728,662 M2I probably benign Het
Cul3 T C 1: 80,276,439 N540S probably damaging Het
Fat2 G A 11: 55,296,105 T1305I probably benign Het
Fbxw8 A G 5: 118,142,666 probably null Het
Gm9195 A T 14: 72,431,775 L2649H probably damaging Het
Gprc5c A G 11: 114,864,105 I203V probably benign Het
Hmcn1 T C 1: 150,743,796 D1189G probably benign Het
Hnrnpl C A 7: 28,818,584 probably benign Het
Homer1 T A 13: 93,341,862 Y38N probably damaging Het
Itgb5 A G 16: 33,946,592 T707A probably benign Het
Lmbrd1 G A 1: 24,685,428 R31Q probably damaging Het
Mbtps1 G A 8: 119,538,137 P341S probably damaging Het
Mlxip A G 5: 123,442,449 probably null Het
Myh13 A T 11: 67,361,400 T1445S probably benign Het
Ncapg C T 5: 45,670,132 A37V probably benign Het
Neb A G 2: 52,207,747 F4909L probably damaging Het
Nrcam T A 12: 44,540,963 W141R probably damaging Het
Olfr424 T G 1: 174,137,248 F168C probably damaging Het
Phykpl A G 11: 51,593,954 E247G probably damaging Het
Plekhh2 A G 17: 84,566,287 I333M possibly damaging Het
Sorcs2 A G 5: 36,077,966 F69L probably damaging Het
Sspo C A 6: 48,491,046 T349K possibly damaging Het
Stap2 A G 17: 55,999,746 S276P probably benign Het
Tle1 A G 4: 72,141,280 S275P probably damaging Het
Topors G A 4: 40,261,896 Q463* probably null Het
Tsc1 A G 2: 28,686,989 D1101G possibly damaging Het
Tyrp1 G A 4: 80,846,747 A54T probably benign Het
Vcam1 A G 3: 116,126,062 V185A possibly damaging Het
Vmn2r19 T A 6: 123,336,535 *855R probably null Het
Other mutations in Dll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Dll4 APN 2 119331109 missense probably damaging 1.00
IGL01149:Dll4 APN 2 119332745 missense probably damaging 1.00
IGL02511:Dll4 APN 2 119326466 missense probably damaging 0.99
PIT4519001:Dll4 UTSW 2 119332416 missense probably benign 0.01
R0316:Dll4 UTSW 2 119331153 missense probably damaging 1.00
R0725:Dll4 UTSW 2 119332689 missense probably damaging 1.00
R0840:Dll4 UTSW 2 119326485 missense probably benign 0.01
R1014:Dll4 UTSW 2 119331157 missense probably damaging 1.00
R1650:Dll4 UTSW 2 119331130 missense probably damaging 1.00
R3813:Dll4 UTSW 2 119331029 missense possibly damaging 0.65
R3974:Dll4 UTSW 2 119334092 missense probably damaging 0.98
R5320:Dll4 UTSW 2 119326487 missense probably damaging 0.97
R6166:Dll4 UTSW 2 119334626 critical splice acceptor site probably null
R6305:Dll4 UTSW 2 119330657 missense probably benign 0.01
R6455:Dll4 UTSW 2 119333795 splice site probably null
R6843:Dll4 UTSW 2 119325994 start gained probably benign
R7204:Dll4 UTSW 2 119328573 missense probably damaging 0.98
R7251:Dll4 UTSW 2 119332292 missense probably damaging 1.00
Z1176:Dll4 UTSW 2 119326052 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CACACCCAGGGAGACTAAGTAG -3'
(R):5'- GCACTCATAATGTCCGAAGTG -3'

Sequencing Primer
(F):5'- TAAGTAGCAAGATTCTGGGACCCTC -3'
(R):5'- CATAATGTCCGAAGTGGTCATCGC -3'
Posted On2018-06-22