Incidental Mutation 'R6582:Olfr218'
ID524127
Institutional Source Beutler Lab
Gene Symbol Olfr218
Ensembl Gene ENSMUSG00000046643
Gene Nameolfactory receptor 218
SynonymsOlfr1405-ps1, GA_x6K02T2R7CC-643715-642847, GA_x6K02SYWG4P-534-1100, MOR267-3, MOR267-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6582 (G1)
Quality Score213.009
Status Validated
Chromosome1
Chromosomal Location173197808-173206336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 173204280 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 308 (R308L)
Ref Sequence ENSEMBL: ENSMUSP00000150815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057548] [ENSMUST00000215844] [ENSMUST00000216603]
Predicted Effect probably benign
Transcript: ENSMUST00000057548
AA Change: R308L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053317
Gene: ENSMUSG00000046643
AA Change: R308L

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.4e-58 PFAM
Pfam:7tm_1 42 291 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215844
AA Change: R308L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216603
AA Change: R308L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Olfr218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03404:Olfr218 APN 1 173204199 missense probably benign 0.08
R0265:Olfr218 UTSW 1 173203917 missense probably benign 0.10
R1388:Olfr218 UTSW 1 173203878 missense probably benign 0.01
R1463:Olfr218 UTSW 1 173203367 missense probably benign
R1547:Olfr218 UTSW 1 173203672 nonsense probably null
R1698:Olfr218 UTSW 1 173203371 missense probably damaging 1.00
R1892:Olfr218 UTSW 1 173204228 missense probably damaging 1.00
R4773:Olfr218 UTSW 1 173204229 missense probably damaging 1.00
R4939:Olfr218 UTSW 1 173203463 missense possibly damaging 0.95
R5473:Olfr218 UTSW 1 173204165 missense probably benign 0.02
R6149:Olfr218 UTSW 1 173204015 missense probably benign 0.15
R7151:Olfr218 UTSW 1 173204066 missense probably damaging 1.00
R8120:Olfr218 UTSW 1 173203935 missense probably benign 0.31
R8510:Olfr218 UTSW 1 173203844 missense probably damaging 0.96
Z1176:Olfr218 UTSW 1 173203797 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGATTGCCTCAGCTGAAGG -3'
(R):5'- TCACTTGCATGCATATAAAGGCAC -3'

Sequencing Primer
(F):5'- CCGGAAGAAGGCCTTTGC -3'
(R):5'- GCATGCATATAAAGGCACTAAAATG -3'
Posted On2018-06-22