Incidental Mutation 'R6582:Mark1'
ID524129
Institutional Source Beutler Lab
Gene Symbol Mark1
Ensembl Gene ENSMUSG00000026620
Gene NameMAP/microtubule affinity regulating kinase 1
SynonymsEmk3, B930025N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R6582 (G1)
Quality Score222.009
Status Validated
Chromosome1
Chromosomal Location184896789-184999570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 184912589 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 390 (S390L)
Ref Sequence ENSEMBL: ENSMUSP00000027929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027929
AA Change: S390L

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027929
Gene: ENSMUSG00000026620
AA Change: S390L

DomainStartEndE-ValueType
S_TKc 60 311 1.12e-108 SMART
low complexity region 316 328 N/A INTRINSIC
UBA 332 369 4.56e-9 SMART
low complexity region 376 386 N/A INTRINSIC
low complexity region 523 547 N/A INTRINSIC
low complexity region 585 599 N/A INTRINSIC
Pfam:KA1 751 795 4.5e-23 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Mark1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mark1 APN 1 184898603 missense probably damaging 1.00
IGL00674:Mark1 APN 1 184912106 missense probably benign
IGL01903:Mark1 APN 1 184929380 splice site probably benign
IGL02004:Mark1 APN 1 184912589 missense possibly damaging 0.82
IGL03177:Mark1 APN 1 184944907 missense probably damaging 1.00
IGL03189:Mark1 APN 1 184919693 missense probably damaging 0.96
IGL03391:Mark1 APN 1 184919435 unclassified probably benign
R0277:Mark1 UTSW 1 184944952 missense possibly damaging 0.89
R0744:Mark1 UTSW 1 184921608 missense probably damaging 1.00
R0973:Mark1 UTSW 1 184921604 missense probably damaging 1.00
R1331:Mark1 UTSW 1 184928048 missense probably damaging 1.00
R2061:Mark1 UTSW 1 184928063 missense probably damaging 1.00
R2136:Mark1 UTSW 1 184919573 missense probably damaging 1.00
R2306:Mark1 UTSW 1 184900861 splice site probably benign
R3159:Mark1 UTSW 1 184908387 missense probably damaging 1.00
R3905:Mark1 UTSW 1 184908435 splice site probably null
R4321:Mark1 UTSW 1 184898674 missense possibly damaging 0.46
R4512:Mark1 UTSW 1 184907089 missense probably benign 0.21
R4715:Mark1 UTSW 1 184912132 missense probably benign 0.00
R4829:Mark1 UTSW 1 184905527 missense possibly damaging 0.82
R5163:Mark1 UTSW 1 184905610 missense probably damaging 0.98
R5222:Mark1 UTSW 1 184928091 missense probably damaging 1.00
R5680:Mark1 UTSW 1 184944816 missense probably damaging 1.00
R6943:Mark1 UTSW 1 184898787 missense probably damaging 1.00
R6979:Mark1 UTSW 1 184912628 missense possibly damaging 0.77
R7031:Mark1 UTSW 1 184912632 missense possibly damaging 0.82
R7455:Mark1 UTSW 1 184919750 missense probably damaging 0.99
R7470:Mark1 UTSW 1 184928044 nonsense probably null
R7715:Mark1 UTSW 1 184907234 missense probably damaging 0.98
R8193:Mark1 UTSW 1 184928052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTATGATCGGTCAGTCACCCAG -3'
(R):5'- ATCCCGTGTTTGAGGCAATGG -3'

Sequencing Primer
(F):5'- AGCGATGCCCGTCTGAGAAG -3'
(R):5'- GGTTAGACAAGTAACCTGGTGTG -3'
Posted On2018-06-22