Incidental Mutation 'R6582:Wdsub1'
ID524131
Institutional Source Beutler Lab
Gene Symbol Wdsub1
Ensembl Gene ENSMUSG00000026988
Gene NameWD repeat, SAM and U-box domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6582 (G1)
Quality Score201.009
Status Validated
Chromosome2
Chromosomal Location59852364-59882591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59878308 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 74 (T74A)
Ref Sequence ENSEMBL: ENSMUSP00000028368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028368] [ENSMUST00000102751] [ENSMUST00000128671] [ENSMUST00000133809] [ENSMUST00000140475]
Predicted Effect probably damaging
Transcript: ENSMUST00000028368
AA Change: T74A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028368
Gene: ENSMUSG00000026988
AA Change: T74A

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Ubox 405 468 1.69e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102751
AA Change: T74A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099812
Gene: ENSMUSG00000026988
AA Change: T74A

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Pfam:U-box 402 423 9.3e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128671
AA Change: T74A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121242
Gene: ENSMUSG00000026988
AA Change: T74A

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
Blast:WD40 169 194 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131285
Predicted Effect probably benign
Transcript: ENSMUST00000133809
SMART Domains Protein: ENSMUSP00000114814
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 7 46 1.5e-3 SMART
WD40 48 96 2.48e-4 SMART
WD40 106 145 6e-3 SMART
low complexity region 163 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139689
SMART Domains Protein: ENSMUSP00000121438
Gene: ENSMUSG00000026988

DomainStartEndE-ValueType
WD40 1 32 4.28e0 SMART
WD40 34 82 2.48e-4 SMART
WD40 92 131 4.91e-8 SMART
WD40 134 173 7.05e-9 SMART
Pfam:SAM_2 193 241 5.3e-10 PFAM
Pfam:SAM_1 194 241 2.4e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000140475
AA Change: T74A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114811
Gene: ENSMUSG00000026988
AA Change: T74A

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
Blast:WD40 169 194 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144343
Meta Mutation Damage Score 0.1392 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Wdsub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Wdsub1 APN 2 59858736 missense probably damaging 1.00
IGL02887:Wdsub1 APN 2 59852832 missense probably damaging 0.99
IGL02984:Wdsub1 UTSW 2 59876829 missense probably damaging 1.00
R0116:Wdsub1 UTSW 2 59876665 splice site probably null
R0504:Wdsub1 UTSW 2 59878325 missense possibly damaging 0.93
R1437:Wdsub1 UTSW 2 59878133 missense probably damaging 0.98
R1452:Wdsub1 UTSW 2 59876800 missense probably null
R1566:Wdsub1 UTSW 2 59876715 missense probably damaging 1.00
R1767:Wdsub1 UTSW 2 59858714 missense probably damaging 1.00
R2938:Wdsub1 UTSW 2 59873286 missense possibly damaging 0.68
R4209:Wdsub1 UTSW 2 59876805 missense probably damaging 1.00
R4583:Wdsub1 UTSW 2 59878317 missense probably damaging 1.00
R4794:Wdsub1 UTSW 2 59862844 missense possibly damaging 0.78
R4803:Wdsub1 UTSW 2 59870399 intron probably benign
R4987:Wdsub1 UTSW 2 59870393 intron probably benign
R4989:Wdsub1 UTSW 2 59870414 intron probably benign
R5311:Wdsub1 UTSW 2 59878529 utr 5 prime probably benign
R5402:Wdsub1 UTSW 2 59870478 missense probably benign
R5408:Wdsub1 UTSW 2 59861543 unclassified probably benign
R5572:Wdsub1 UTSW 2 59862707 missense possibly damaging 0.95
R5681:Wdsub1 UTSW 2 59852895 missense probably damaging 1.00
R5864:Wdsub1 UTSW 2 59878475 missense probably damaging 1.00
R6638:Wdsub1 UTSW 2 59870441 intron probably benign
R6678:Wdsub1 UTSW 2 59862631 missense probably benign 0.45
R6842:Wdsub1 UTSW 2 59878188 missense probably benign 0.09
R6907:Wdsub1 UTSW 2 59861684 missense possibly damaging 0.59
R7041:Wdsub1 UTSW 2 59852880 missense probably damaging 1.00
R7288:Wdsub1 UTSW 2 59878143 missense possibly damaging 0.50
R7769:Wdsub1 UTSW 2 59878419 missense probably damaging 1.00
R7942:Wdsub1 UTSW 2 59876717 missense probably damaging 1.00
R8291:Wdsub1 UTSW 2 59862674 missense probably damaging 1.00
R8458:Wdsub1 UTSW 2 59861701 missense probably benign 0.00
X0023:Wdsub1 UTSW 2 59876754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTTAAGCAGCCATACC -3'
(R):5'- TTCACACGCTGGCTGATCAC -3'

Sequencing Primer
(F):5'- GGGTTTAAGCAGCCATACCTATATAG -3'
(R):5'- CTGATCACGGTGATGACGTCAG -3'
Posted On2018-06-22