Incidental Mutation 'R6582:Gbp2b'
Institutional Source Beutler Lab
Gene Symbol Gbp2b
Ensembl Gene ENSMUSG00000040264
Gene Nameguanylate binding protein 2b
SynonymsGbp1, Mpa1, Mag-1, Gbp-1, Mpa-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosomal Location142594847-142619179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142611040 bp
Amino Acid Change Glutamic Acid to Glycine at position 484 (E484G)
Ref Sequence ENSEMBL: ENSMUSP00000029936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029936]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029936
AA Change: E484G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264
AA Change: E484G

Pfam:GBP 18 280 4.1e-122 PFAM
Pfam:GBP_C 282 578 5.5e-125 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Gbp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Gbp2b APN 3 142598312 missense probably damaging 1.00
IGL01892:Gbp2b APN 3 142603620 missense probably benign 0.03
IGL01989:Gbp2b APN 3 142611440 missense probably benign 0.19
IGL02019:Gbp2b APN 3 142606990 missense possibly damaging 0.52
IGL02338:Gbp2b APN 3 142604226 missense probably benign 0.09
IGL02657:Gbp2b APN 3 142604112 missense probably damaging 1.00
IGL03148:Gbp2b APN 3 142606881 missense probably benign 0.00
FR4304:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4340:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4342:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4589:Gbp2b UTSW 3 142603652 missense probably benign 0.00
R0329:Gbp2b UTSW 3 142608176 missense probably benign 0.01
R0345:Gbp2b UTSW 3 142608183 missense probably damaging 1.00
R0358:Gbp2b UTSW 3 142606789 missense probably damaging 1.00
R0732:Gbp2b UTSW 3 142606978 missense probably benign
R1163:Gbp2b UTSW 3 142599096 missense probably damaging 1.00
R1550:Gbp2b UTSW 3 142606830 missense probably damaging 0.99
R1629:Gbp2b UTSW 3 142610974 missense possibly damaging 0.93
R1886:Gbp2b UTSW 3 142608302 missense probably benign
R1887:Gbp2b UTSW 3 142608302 missense probably benign
R2188:Gbp2b UTSW 3 142608279 missense probably benign 0.44
R2261:Gbp2b UTSW 3 142606735 missense probably benign 0.00
R3977:Gbp2b UTSW 3 142603709 missense probably benign 0.02
R4718:Gbp2b UTSW 3 142598995 missense probably damaging 1.00
R4788:Gbp2b UTSW 3 142611410 missense probably benign 0.21
R4807:Gbp2b UTSW 3 142598245 missense probably benign 0.02
R5042:Gbp2b UTSW 3 142611463 missense probably benign 0.03
R5087:Gbp2b UTSW 3 142598254 missense probably damaging 1.00
R5114:Gbp2b UTSW 3 142598185 missense probably damaging 1.00
R5414:Gbp2b UTSW 3 142599091 missense probably damaging 1.00
R5567:Gbp2b UTSW 3 142611365 missense possibly damaging 0.75
R5625:Gbp2b UTSW 3 142599045 missense probably damaging 1.00
R5685:Gbp2b UTSW 3 142608158 missense probably benign
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6408:Gbp2b UTSW 3 142618138 missense probably benign 0.00
R6500:Gbp2b UTSW 3 142611491 missense probably benign 0.06
R6581:Gbp2b UTSW 3 142608238 nonsense probably null
R6847:Gbp2b UTSW 3 142598179 missense probably damaging 0.96
R6923:Gbp2b UTSW 3 142600559 missense probably benign 0.01
R7120:Gbp2b UTSW 3 142606746 missense probably benign 0.01
R7255:Gbp2b UTSW 3 142608117 missense probably damaging 1.00
R7454:Gbp2b UTSW 3 142598159 missense possibly damaging 0.75
R7643:Gbp2b UTSW 3 142603609 missense probably benign 0.07
R8039:Gbp2b UTSW 3 142618164 missense probably benign 0.02
R8312:Gbp2b UTSW 3 142599051 missense probably benign
R8312:Gbp2b UTSW 3 142599054 missense probably damaging 0.96
R8391:Gbp2b UTSW 3 142604133 missense probably damaging 1.00
R8418:Gbp2b UTSW 3 142603705 missense probably benign 0.01
Z1177:Gbp2b UTSW 3 142604316 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-06-22