Incidental Mutation 'R6582:Fyb2'
Institutional Source Beutler Lab
Gene Symbol Fyb2
Ensembl Gene ENSMUSG00000078612
Gene NameFYN binding protein 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosomal Location104913456-105016863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104945542 bp
Amino Acid Change Asparagine to Aspartic acid at position 214 (N214D)
Ref Sequence ENSEMBL: ENSMUSP00000102415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106803] [ENSMUST00000106804]
Predicted Effect probably benign
Transcript: ENSMUST00000106803
AA Change: N214D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102415
Gene: ENSMUSG00000078612
AA Change: N214D

low complexity region 120 132 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 537 549 N/A INTRINSIC
low complexity region 567 578 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
SH3 735 791 3.82e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106804
AA Change: N150D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102416
Gene: ENSMUSG00000078612
AA Change: N150D

low complexity region 56 68 N/A INTRINSIC
low complexity region 276 285 N/A INTRINSIC
low complexity region 378 395 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
SH3 671 727 3.82e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Fyb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Fyb2 APN 4 105015716 missense probably damaging 1.00
IGL01155:Fyb2 APN 4 104999386 missense probably benign 0.00
IGL01632:Fyb2 APN 4 104995811 missense probably benign
IGL01746:Fyb2 APN 4 104945207 missense probably benign 0.01
IGL02381:Fyb2 APN 4 104948666 splice site probably benign
IGL02590:Fyb2 APN 4 104979053 missense probably damaging 1.00
IGL02885:Fyb2 APN 4 105003921 missense probably damaging 0.99
IGL03114:Fyb2 APN 4 104995778 missense probably damaging 0.97
IGL03189:Fyb2 APN 4 105015742 missense probably damaging 1.00
IGL03231:Fyb2 APN 4 104986263 nonsense probably null
R0076:Fyb2 UTSW 4 104945464 missense possibly damaging 0.46
R0662:Fyb2 UTSW 4 104995698 missense possibly damaging 0.46
R0723:Fyb2 UTSW 4 105015866 missense probably benign 0.00
R1216:Fyb2 UTSW 4 104995706 missense possibly damaging 0.86
R1672:Fyb2 UTSW 4 104950862 missense probably benign 0.10
R1710:Fyb2 UTSW 4 105003916 missense probably damaging 1.00
R1900:Fyb2 UTSW 4 104945455 missense probably benign 0.06
R1965:Fyb2 UTSW 4 104913649 missense probably benign 0.00
R2106:Fyb2 UTSW 4 104945572 missense probably benign 0.01
R5191:Fyb2 UTSW 4 104995797 missense possibly damaging 0.88
R5236:Fyb2 UTSW 4 104948760 missense probably benign 0.00
R5277:Fyb2 UTSW 4 105015679 missense probably damaging 1.00
R5502:Fyb2 UTSW 4 104945324 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105013321 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105015644 missense probably damaging 1.00
R6167:Fyb2 UTSW 4 104945464 missense possibly damaging 0.46
R6169:Fyb2 UTSW 4 105000516 missense probably benign 0.16
R6371:Fyb2 UTSW 4 104995778 missense probably damaging 0.97
R6713:Fyb2 UTSW 4 104990235 missense probably benign 0.16
R6719:Fyb2 UTSW 4 105010459 missense probably benign 0.07
R7484:Fyb2 UTSW 4 105013302 missense probably benign 0.01
R7534:Fyb2 UTSW 4 104999348 nonsense probably null
R7590:Fyb2 UTSW 4 104945246 missense probably benign 0.01
R7699:Fyb2 UTSW 4 105010454 missense probably benign 0.07
R7700:Fyb2 UTSW 4 105010454 missense probably benign 0.07
R8041:Fyb2 UTSW 4 105000484 missense possibly damaging 0.82
R8755:Fyb2 UTSW 4 105003889 missense unknown
R8817:Fyb2 UTSW 4 104945455 missense probably benign 0.06
R8873:Fyb2 UTSW 4 104999341 missense probably damaging 1.00
R8914:Fyb2 UTSW 4 105000503 missense probably benign 0.09
X0018:Fyb2 UTSW 4 104945210 missense probably benign 0.04
Z1176:Fyb2 UTSW 4 104913660 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-06-22