Incidental Mutation 'R6582:Fbxw8'
ID524142
Institutional Source Beutler Lab
Gene Symbol Fbxw8
Ensembl Gene ENSMUSG00000032867
Gene NameF-box and WD-40 domain protein 8
SynonymsFbx29, FBW6, FBXO29, 4930438M06Rik, FBW8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location118064965-118155464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118124963 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 217 (R217L)
Ref Sequence ENSEMBL: ENSMUSP00000047012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049474]
Predicted Effect probably benign
Transcript: ENSMUST00000049474
AA Change: R217L

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000047012
Gene: ENSMUSG00000032867
AA Change: R217L

DomainStartEndE-ValueType
low complexity region 16 39 N/A INTRINSIC
low complexity region 51 75 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
FBOX 119 159 5e-5 SMART
WD40 198 236 6.16e0 SMART
WD40 248 285 7.1e1 SMART
WD40 289 327 7.36e1 SMART
Blast:WD40 373 418 2e-8 BLAST
WD40 421 461 1.6e0 SMART
WD40 464 501 2.15e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201545
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains a WD-40 domain, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display partial late embryonic lethality with embryonic growth retardation and abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Fbxw8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Fbxw8 APN 5 118068097 missense probably benign 0.00
IGL00435:Fbxw8 APN 5 118068137 missense probably benign 0.01
IGL00674:Fbxw8 APN 5 118095593 missense possibly damaging 0.94
IGL01306:Fbxw8 APN 5 118113720 missense possibly damaging 0.88
IGL02389:Fbxw8 APN 5 118128955 missense possibly damaging 0.57
IGL02438:Fbxw8 APN 5 118095693 missense probably benign 0.09
IGL02553:Fbxw8 APN 5 118066060 unclassified probably benign
IGL02752:Fbxw8 APN 5 118142750 missense probably damaging 1.00
IGL02975:Fbxw8 APN 5 118077695 missense probably benign 0.02
IGL03177:Fbxw8 APN 5 118128980 splice site probably benign
IGL03333:Fbxw8 APN 5 118095595 missense possibly damaging 0.94
IGL03407:Fbxw8 APN 5 118142676 missense probably damaging 1.00
ANU23:Fbxw8 UTSW 5 118113720 missense possibly damaging 0.88
R0135:Fbxw8 UTSW 5 118070487 missense probably damaging 1.00
R0760:Fbxw8 UTSW 5 118065901 splice site probably null
R1115:Fbxw8 UTSW 5 118077571 splice site probably benign
R1498:Fbxw8 UTSW 5 118065785 unclassified probably benign
R1689:Fbxw8 UTSW 5 118077617 missense probably damaging 0.97
R1897:Fbxw8 UTSW 5 118128876 missense probably benign 0.16
R2160:Fbxw8 UTSW 5 118124988 missense probably damaging 1.00
R2345:Fbxw8 UTSW 5 118065807 unclassified probably benign
R3743:Fbxw8 UTSW 5 118113639 missense probably damaging 1.00
R3935:Fbxw8 UTSW 5 118095718 missense probably benign 0.38
R4910:Fbxw8 UTSW 5 118125027 splice site probably null
R5220:Fbxw8 UTSW 5 118095711 missense possibly damaging 0.69
R5628:Fbxw8 UTSW 5 118092557 missense probably damaging 1.00
R6161:Fbxw8 UTSW 5 118092675 missense possibly damaging 0.94
R6184:Fbxw8 UTSW 5 118113749 missense probably damaging 1.00
R6617:Fbxw8 UTSW 5 118142666 critical splice donor site probably null
R6785:Fbxw8 UTSW 5 118092689 missense probably damaging 1.00
R7363:Fbxw8 UTSW 5 118124992 missense probably damaging 0.97
R7395:Fbxw8 UTSW 5 118068215 missense probably damaging 1.00
R7674:Fbxw8 UTSW 5 118124971 nonsense probably null
R8428:Fbxw8 UTSW 5 118077698 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCTTCTCACTTAGGAGACACAC -3'
(R):5'- ACTGACTGGAATGTGGTGCG -3'

Sequencing Primer
(F):5'- TTCTCACTTAGGAGACACACAAATG -3'
(R):5'- AGAGCATGTTACTGGGGA -3'
Posted On2018-06-22