Incidental Mutation 'R6582:Vmn1r71'
ID524148
Institutional Source Beutler Lab
Gene Symbol Vmn1r71
Ensembl Gene ENSMUSG00000059206
Gene Namevomeronasal 1 receptor 71
SynonymsV1re13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location10744543-10754364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10748681 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 27 (I27F)
Ref Sequence ENSEMBL: ENSMUSP00000154779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079113] [ENSMUST00000226874] [ENSMUST00000227003] [ENSMUST00000227702] [ENSMUST00000227940] [ENSMUST00000228098] [ENSMUST00000228248] [ENSMUST00000228374] [ENSMUST00000228526] [ENSMUST00000228561]
Predicted Effect probably benign
Transcript: ENSMUST00000079113
AA Change: I27F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078116
Gene: ENSMUSG00000059206
AA Change: I27F

DomainStartEndE-ValueType
Pfam:TAS2R 3 304 2e-8 PFAM
Pfam:7tm_1 22 289 3.1e-6 PFAM
Pfam:V1R 34 297 4.8e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210233
Predicted Effect probably benign
Transcript: ENSMUST00000226874
AA Change: I27F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000227003
AA Change: I27F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000227702
AA Change: I27F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000227940
AA Change: I27F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228098
AA Change: I27F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228248
AA Change: I27F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228374
AA Change: I27F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228526
AA Change: I27F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228561
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Vmn1r71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Vmn1r71 APN 7 10748119 missense probably damaging 0.99
IGL01921:Vmn1r71 APN 7 10748272 missense probably benign 0.16
IGL02397:Vmn1r71 APN 7 10748272 missense probably benign 0.27
IGL02654:Vmn1r71 APN 7 10748315 missense probably benign 0.42
IGL02900:Vmn1r71 APN 7 10748674 missense probably benign 0.28
IGL03236:Vmn1r71 APN 7 10748284 missense probably benign 0.11
IGL03269:Vmn1r71 APN 7 10748644 missense possibly damaging 0.88
FR4976:Vmn1r71 UTSW 7 10748121 missense probably benign
R0389:Vmn1r71 UTSW 7 10748311 missense probably benign 0.05
R0443:Vmn1r71 UTSW 7 10748311 missense probably benign 0.05
R0470:Vmn1r71 UTSW 7 10748092 missense possibly damaging 0.64
R0471:Vmn1r71 UTSW 7 10748092 missense possibly damaging 0.64
R0472:Vmn1r71 UTSW 7 10748092 missense possibly damaging 0.64
R0567:Vmn1r71 UTSW 7 10748629 missense probably damaging 1.00
R1498:Vmn1r71 UTSW 7 10748648 missense probably benign 0.01
R1745:Vmn1r71 UTSW 7 10748269 missense probably benign 0.05
R2350:Vmn1r71 UTSW 7 10747919 missense probably benign 0.00
R2970:Vmn1r71 UTSW 7 10748714 missense possibly damaging 0.67
R3522:Vmn1r71 UTSW 7 10747865 missense probably benign 0.03
R4193:Vmn1r71 UTSW 7 10748248 missense possibly damaging 0.55
R4736:Vmn1r71 UTSW 7 10747864 missense possibly damaging 0.94
R5115:Vmn1r71 UTSW 7 10747958 missense probably benign 0.00
R6108:Vmn1r71 UTSW 7 10748618 missense probably benign 0.01
R6455:Vmn1r71 UTSW 7 10748404 missense probably benign 0.01
R6696:Vmn1r71 UTSW 7 10748474 missense probably damaging 0.96
R6778:Vmn1r71 UTSW 7 10748216 missense probably benign 0.02
R7347:Vmn1r71 UTSW 7 10748501 missense not run
R7631:Vmn1r71 UTSW 7 10748451 missense probably damaging 1.00
R7795:Vmn1r71 UTSW 7 10748209 missense probably damaging 0.98
R7820:Vmn1r71 UTSW 7 10748725 missense possibly damaging 0.85
R7836:Vmn1r71 UTSW 7 10748350 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GTGCAAATGGACATACTTCGAC -3'
(R):5'- TGGATTAAAGGTGTCCTCTTTCAC -3'

Sequencing Primer
(F):5'- GGACATACTTCGACTAAATCCTTG -3'
(R):5'- TCTTTCACCATAGTCTAGAACCAG -3'
Posted On2018-06-22