Incidental Mutation 'R6617:Hnrnpl'
ID524149
Institutional Source Beutler Lab
Gene Symbol Hnrnpl
Ensembl Gene ENSMUSG00000015165
Gene Nameheterogeneous nuclear ribonucleoprotein L
SynonymsHnrpl, D830027H13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6617 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28808541-28822266 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 28818584 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038572] [ENSMUST00000172529] [ENSMUST00000172884] [ENSMUST00000174548] [ENSMUST00000174882]
Predicted Effect probably benign
Transcript: ENSMUST00000038572
SMART Domains Protein: ENSMUSP00000049407
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172529
SMART Domains Protein: ENSMUSP00000133932
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 9e-20 BLAST
RRM 61 131 4.75e-7 SMART
low complexity region 184 209 N/A INTRINSIC
low complexity region 226 244 N/A INTRINSIC
RRM 250 319 5.09e-7 SMART
Blast:RRM_2 369 442 6e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172841
Predicted Effect probably benign
Transcript: ENSMUST00000172884
SMART Domains Protein: ENSMUSP00000134271
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
Blast:RRM 1 39 1e-21 BLAST
SCOP:d1qm9a1 3 61 3e-3 SMART
Pfam:RRM_6 67 113 5.7e-5 PFAM
Pfam:RRM_1 70 113 1.3e-5 PFAM
Pfam:RRM_5 78 113 9.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174396
Predicted Effect unknown
Transcript: ENSMUST00000174477
AA Change: A323D
SMART Domains Protein: ENSMUSP00000134734
Gene: ENSMUSG00000015165
AA Change: A323D

DomainStartEndE-ValueType
low complexity region 4 49 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
RRM 92 161 9.8e-9 SMART
RRM 183 253 4.75e-7 SMART
low complexity region 339 368 N/A INTRINSIC
low complexity region 385 403 N/A INTRINSIC
RRM 409 478 5.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174526
Predicted Effect probably benign
Transcript: ENSMUST00000174548
SMART Domains Protein: ENSMUSP00000133728
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174882
SMART Domains Protein: ENSMUSP00000133952
Gene: ENSMUSG00000015165

DomainStartEndE-ValueType
RRM 1 61 5.18e-1 SMART
RRM 83 153 4.75e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174755
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterogeneous nuclear RNAs (hnRNAs) which include mRNA precursors and mature mRNAs are associated with specific proteins to form heterogenous ribonucleoprotein (hnRNP) complexes. Heterogeneous nuclear ribonucleoprotein L is among the proteins that are stably associated with hnRNP complexes and along with other hnRNP proteins is likely to play a major role in the formation, packaging, processing, and function of mRNA. Heterogeneous nuclear ribonucleoprotein L is present in the nucleoplasm as part of the HNRP complex. HNRP proteins have also been identified outside of the nucleoplasm. Exchange of hnRNP for mRNA-binding proteins accompanies transport of mRNA from the nucleus to the cytoplasm. Since HNRP proteins have been shown to shuttle between the nucleus and the cytoplasm, it is possible that they also have cytoplasmic functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic letahlity after E3.5. Mice homozygous for a conditional allele activated in thymocytes exhibit decreased T cells in the periphery associated with impaired thymocyte chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,490,532 I323K possibly damaging Het
Agbl4 T A 4: 110,580,135 V81D probably damaging Het
Akap13 A G 7: 75,730,363 D2147G possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Arhgef18 T C 8: 3,439,592 L308P probably damaging Het
Atad2b C A 12: 5,024,668 L1076I probably benign Het
Chp2 T C 7: 122,220,694 V59A probably benign Het
Cped1 T A 6: 22,215,547 C555* probably null Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Crispld1 G A 1: 17,728,662 M2I probably benign Het
Cul3 T C 1: 80,276,439 N540S probably damaging Het
Dll4 A G 2: 119,327,931 T134A probably benign Het
Fat2 G A 11: 55,296,105 T1305I probably benign Het
Fbxw8 A G 5: 118,142,666 probably null Het
Gm9195 A T 14: 72,431,775 L2649H probably damaging Het
Gprc5c A G 11: 114,864,105 I203V probably benign Het
Hmcn1 T C 1: 150,743,796 D1189G probably benign Het
Homer1 T A 13: 93,341,862 Y38N probably damaging Het
Itgb5 A G 16: 33,946,592 T707A probably benign Het
Lmbrd1 G A 1: 24,685,428 R31Q probably damaging Het
Mbtps1 G A 8: 119,538,137 P341S probably damaging Het
Mlxip A G 5: 123,442,449 probably null Het
Myh13 A T 11: 67,361,400 T1445S probably benign Het
Ncapg C T 5: 45,670,132 A37V probably benign Het
Neb A G 2: 52,207,747 F4909L probably damaging Het
Nrcam T A 12: 44,540,963 W141R probably damaging Het
Olfr424 T G 1: 174,137,248 F168C probably damaging Het
Phykpl A G 11: 51,593,954 E247G probably damaging Het
Plekhh2 A G 17: 84,566,287 I333M possibly damaging Het
Sorcs2 A G 5: 36,077,966 F69L probably damaging Het
Sspo C A 6: 48,491,046 T349K possibly damaging Het
Stap2 A G 17: 55,999,746 S276P probably benign Het
Tle1 A G 4: 72,141,280 S275P probably damaging Het
Topors G A 4: 40,261,896 Q463* probably null Het
Tsc1 A G 2: 28,686,989 D1101G possibly damaging Het
Tyrp1 G A 4: 80,846,747 A54T probably benign Het
Vcam1 A G 3: 116,126,062 V185A possibly damaging Het
Vmn2r19 T A 6: 123,336,535 *855R probably null Het
Other mutations in Hnrnpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Hnrnpl APN 7 28813373 missense probably damaging 1.00
IGL00783:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL00784:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL03248:Hnrnpl APN 7 28814080 missense probably benign 0.00
R0143:Hnrnpl UTSW 7 28814192 splice site probably benign
R1529:Hnrnpl UTSW 7 28813923 missense possibly damaging 0.74
R1567:Hnrnpl UTSW 7 28820183 missense possibly damaging 0.73
R3786:Hnrnpl UTSW 7 28811011 unclassified probably benign
R4837:Hnrnpl UTSW 7 28817337 missense probably benign 0.00
R5412:Hnrnpl UTSW 7 28811104 unclassified probably benign
R7238:Hnrnpl UTSW 7 28813975 missense
R8283:Hnrnpl UTSW 7 28814272 missense
R8336:Hnrnpl UTSW 7 28814037 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCAGGAGTCCGGGGATTCTTTC -3'
(R):5'- GCCATAGACCATGAGCACAG -3'

Sequencing Primer
(F):5'- GGGATTCTTTCTTGTGTTCTATTCC -3'
(R):5'- TGACCATACTGGGGGCCATAG -3'
Posted On2018-06-22