Incidental Mutation 'R6617:Arhgef18'
ID524155
Institutional Source Beutler Lab
Gene Symbol Arhgef18
Ensembl Gene ENSMUSG00000004568
Gene Namerho/rac guanine nucleotide exchange factor (GEF) 18
SynonymsD030053O22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6617 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3393006-3456601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3439592 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 308 (L308P)
Ref Sequence ENSEMBL: ENSMUSP00000004684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004684]
Predicted Effect probably damaging
Transcript: ENSMUST00000004684
AA Change: L308P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568
AA Change: L308P

DomainStartEndE-ValueType
RhoGEF 105 297 2.62e-58 SMART
PH 340 443 5.57e-12 SMART
low complexity region 446 456 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
coiled coil region 697 800 N/A INTRINSIC
low complexity region 887 897 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 963 985 N/A INTRINSIC
low complexity region 991 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156085
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases are GTP binding proteins that regulate a wide spectrum of cellular functions. These cellular processes include cytoskeletal rearrangements, gene transcription, cell growth and motility. Activation of Rho GTPases is under the direct control of guanine nucleotide exchange factors (GEFs). The protein encoded by this gene is a guanine nucleotide exchange factor and belongs to the Rho GTPase GFE family. Family members share a common feature, a Dbl (DH) homology domain followed by a pleckstrin (PH) homology domain. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit greatly reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b T A 12: 113,490,532 I323K possibly damaging Het
Agbl4 T A 4: 110,580,135 V81D probably damaging Het
Akap13 A G 7: 75,730,363 D2147G possibly damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Atad2b C A 12: 5,024,668 L1076I probably benign Het
Chp2 T C 7: 122,220,694 V59A probably benign Het
Cped1 T A 6: 22,215,547 C555* probably null Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Crispld1 G A 1: 17,728,662 M2I probably benign Het
Cul3 T C 1: 80,276,439 N540S probably damaging Het
Dll4 A G 2: 119,327,931 T134A probably benign Het
Fat2 G A 11: 55,296,105 T1305I probably benign Het
Fbxw8 A G 5: 118,142,666 probably null Het
Gm9195 A T 14: 72,431,775 L2649H probably damaging Het
Gprc5c A G 11: 114,864,105 I203V probably benign Het
Hmcn1 T C 1: 150,743,796 D1189G probably benign Het
Hnrnpl C A 7: 28,818,584 probably benign Het
Homer1 T A 13: 93,341,862 Y38N probably damaging Het
Itgb5 A G 16: 33,946,592 T707A probably benign Het
Lmbrd1 G A 1: 24,685,428 R31Q probably damaging Het
Mbtps1 G A 8: 119,538,137 P341S probably damaging Het
Mlxip A G 5: 123,442,449 probably null Het
Myh13 A T 11: 67,361,400 T1445S probably benign Het
Ncapg C T 5: 45,670,132 A37V probably benign Het
Neb A G 2: 52,207,747 F4909L probably damaging Het
Nrcam T A 12: 44,540,963 W141R probably damaging Het
Olfr424 T G 1: 174,137,248 F168C probably damaging Het
Phykpl A G 11: 51,593,954 E247G probably damaging Het
Plekhh2 A G 17: 84,566,287 I333M possibly damaging Het
Sorcs2 A G 5: 36,077,966 F69L probably damaging Het
Sspo C A 6: 48,491,046 T349K possibly damaging Het
Stap2 A G 17: 55,999,746 S276P probably benign Het
Tle1 A G 4: 72,141,280 S275P probably damaging Het
Topors G A 4: 40,261,896 Q463* probably null Het
Tsc1 A G 2: 28,686,989 D1101G possibly damaging Het
Tyrp1 G A 4: 80,846,747 A54T probably benign Het
Vcam1 A G 3: 116,126,062 V185A possibly damaging Het
Vmn2r19 T A 6: 123,336,535 *855R probably null Het
Other mutations in Arhgef18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Arhgef18 APN 8 3429553 missense probably damaging 1.00
IGL01649:Arhgef18 APN 8 3441211 splice site probably benign
IGL01736:Arhgef18 APN 8 3451624 splice site probably benign
IGL02206:Arhgef18 APN 8 3445034 missense probably benign 0.00
IGL02401:Arhgef18 APN 8 3437078 missense probably damaging 1.00
IGL02938:Arhgef18 APN 8 3450802 missense probably benign 0.02
IGL02943:Arhgef18 APN 8 3448553 missense probably damaging 0.99
IGL02990:Arhgef18 APN 8 3444904 missense probably benign 0.02
IGL03162:Arhgef18 APN 8 3441301 splice site probably null
R1622:Arhgef18 UTSW 8 3441272 missense possibly damaging 0.46
R1681:Arhgef18 UTSW 8 3439645 missense probably damaging 1.00
R1726:Arhgef18 UTSW 8 3454228 missense possibly damaging 0.46
R2126:Arhgef18 UTSW 8 3451939 missense probably damaging 0.99
R2161:Arhgef18 UTSW 8 3439575 nonsense probably null
R2878:Arhgef18 UTSW 8 3432759 missense probably benign
R3916:Arhgef18 UTSW 8 3454197 missense probably benign
R4231:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4233:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4234:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4235:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4236:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4450:Arhgef18 UTSW 8 3437097 missense probably damaging 0.97
R4539:Arhgef18 UTSW 8 3447070 missense probably benign
R4670:Arhgef18 UTSW 8 3434897 missense probably damaging 1.00
R4753:Arhgef18 UTSW 8 3444938 missense probably damaging 1.00
R4897:Arhgef18 UTSW 8 3444979 missense probably benign
R5313:Arhgef18 UTSW 8 3451629 critical splice acceptor site probably null
R5698:Arhgef18 UTSW 8 3439499 missense probably damaging 0.99
R5781:Arhgef18 UTSW 8 3439439 intron probably null
R5851:Arhgef18 UTSW 8 3434980 missense probably damaging 1.00
R5897:Arhgef18 UTSW 8 3439682 missense probably damaging 1.00
R5908:Arhgef18 UTSW 8 3453165 missense probably damaging 1.00
R6123:Arhgef18 UTSW 8 3437091 missense probably damaging 0.99
R6136:Arhgef18 UTSW 8 3454507 missense probably benign
R6240:Arhgef18 UTSW 8 3439658 missense probably damaging 1.00
R7575:Arhgef18 UTSW 8 3451635 missense probably damaging 0.99
X0021:Arhgef18 UTSW 8 3434942 missense probably damaging 1.00
Z1088:Arhgef18 UTSW 8 3439628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCTGTAATTCTCTGAGC -3'
(R):5'- GTGGATAGAACCCGAAACCC -3'

Sequencing Primer
(F):5'- TAATTCTCTGAGCAGTGGCCCAAG -3'
(R):5'- GAAACCCACCTTTCAGGCG -3'
Posted On2018-06-22