Incidental Mutation 'R6582:Cenpt'
ID524162
Institutional Source Beutler Lab
Gene Symbol Cenpt
Ensembl Gene ENSMUSG00000036672
Gene Namecentromere protein T
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105844673-105853278 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 105849201 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 171 (L171*)
Ref Sequence ENSEMBL: ENSMUSP00000038188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034365] [ENSMUST00000040776] [ENSMUST00000212431] [ENSMUST00000212552] [ENSMUST00000212566] [ENSMUST00000212839]
Predicted Effect probably benign
Transcript: ENSMUST00000034365
SMART Domains Protein: ENSMUSP00000034365
Gene: ENSMUSG00000031893

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 98 209 3.5e-33 PFAM
coiled coil region 304 342 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040776
AA Change: L171*
SMART Domains Protein: ENSMUSP00000038188
Gene: ENSMUSG00000036672
AA Change: L171*

DomainStartEndE-ValueType
Pfam:CENP-T_N 1 374 4.2e-174 PFAM
Pfam:CENP-T_C 404 507 5.4e-36 PFAM
Pfam:CENP-S 424 479 3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212357
Predicted Effect probably benign
Transcript: ENSMUST00000212431
Predicted Effect probably benign
Transcript: ENSMUST00000212552
Predicted Effect probably benign
Transcript: ENSMUST00000212566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212803
Predicted Effect probably benign
Transcript: ENSMUST00000212839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212873
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 T G 14: 8,042,828 probably null Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Cenpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Cenpt APN 8 105846665 missense possibly damaging 0.52
IGL01970:Cenpt APN 8 105845116 missense probably damaging 1.00
IGL03141:Cenpt APN 8 105851941 missense probably damaging 0.99
IGL03403:Cenpt APN 8 105849665 nonsense probably null
R0089:Cenpt UTSW 8 105846368 missense probably benign 0.00
R0508:Cenpt UTSW 8 105849515 missense possibly damaging 0.81
R0648:Cenpt UTSW 8 105844960 missense probably damaging 0.99
R1460:Cenpt UTSW 8 105848888 missense probably damaging 1.00
R1839:Cenpt UTSW 8 105849014 missense possibly damaging 0.95
R4117:Cenpt UTSW 8 105849700 missense probably benign
R4732:Cenpt UTSW 8 105847136 missense probably benign 0.00
R4733:Cenpt UTSW 8 105847136 missense probably benign 0.00
R6246:Cenpt UTSW 8 105849259 missense possibly damaging 0.95
R6413:Cenpt UTSW 8 105846341 missense possibly damaging 0.64
R7299:Cenpt UTSW 8 105849904 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAAGGATGAAACATCAGC -3'
(R):5'- ACGGTGAATTTCCCTCATAGGC -3'

Sequencing Primer
(F):5'- AGCACTCCTACTCCTACGTGG -3'
(R):5'- GGATCCCCAGAAACTAAAATTGGGC -3'
Posted On2018-06-22