Mutagenetix > Incidental Mutations

Incidental Mutation 'R6582:Dscaml1'

524170

Institutional Source

Beutler Lab

Gene Symbol

Dscaml1

Ensembl Gene

ENSMUSG00000032087

Gene Name

DS cell adhesion molecule like 1

Synonyms

4921507G06Rik, 4930435C18Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Is this an essential gene?

Possibly essential (E-score: 0.565) question?

Stock #

R6582 (G1)

Quality Score

194.009

Status

Validated

Chromosome

Chromosomal Location

45426628-45753712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 45752806 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1993 (R1993Q)

Ref Sequence

ENSEMBL: ENSMUSP00000034592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034592]

Predicted Effect

probably benign
Transcript: ENSMUST00000034592
AA Change: R1993Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: R1993Q

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	28	55	N/A	INTRINSIC
IG_like	96	168	1.22e0	SMART
IG	189	277	1.15e-3	SMART
IGc2	296	359	2.54e-14	SMART
IGc2	385	451	8.12e-13	SMART
IGc2	478	550	9.55e-10	SMART
IGc2	575	640	9.78e-7	SMART
IGc2	666	734	5.93e-6	SMART
IGc2	760	832	6.75e-10	SMART
IG	853	943	1e-3	SMART
FN3	945	1029	6.64e-7	SMART
FN3	1045	1133	9.46e-12	SMART
FN3	1148	1234	3.2e-9	SMART
FN3	1249	1332	3.48e-10	SMART
IGc2	1363	1428	1.49e-11	SMART
FN3	1442	1522	3.42e-9	SMART
FN3	1537	1618	2.14e-1	SMART
low complexity region	1671	1683	N/A	INTRINSIC
low complexity region	2018	2026	N/A	INTRINSIC
low complexity region	2035	2069	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214151

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,258,225	T2369A	probably benign	Het
Abhd6	G	T	14: 8,042,826	G128C	probably damaging	Het
Abhd6	T	G	14: 8,042,828		probably null	Het
Acsm3	A	G	7: 119,779,673	E426G	probably benign	Het
Ankrd11	T	C	8: 122,891,629	D1828G	probably benign	Het
Asmt	T	A	X: 170,675,031		probably null	Het
Casp4	A	G	9: 5,324,884	Q232R	probably benign	Het
Cenpt	A	T	8: 105,849,201	L171*	probably null	Het
Chd3	AGCGGCGGCGGCGGCGGCGG	AGCGGCGGCGGCGGCGG	11: 69,369,156		probably benign	Het
Col5a2	G	T	1: 45,390,115	H948N	possibly damaging	Het
Dnah9	G	T	11: 66,061,097	H1859N	probably damaging	Het
Fbxw8	C	A	5: 118,124,963	R217L	probably benign	Het
Flnb	T	G	14: 7,892,275		probably null	Het
Fyb2	A	G	4: 104,945,542	N214D	probably benign	Het
Gbp2b	A	G	3: 142,611,040	E484G	possibly damaging	Het
Gzmk	A	G	13: 113,180,511	Y45H	probably damaging	Het
Ivl	CCTGCTGCTGCTGCT	CCTGCTGCTGCT	3: 92,571,910		probably benign	Het
Kcnj6	A	G	16: 94,832,826	V142A	possibly damaging	Het
Klri2	A	T	6: 129,739,133	I81K	possibly damaging	Het
Lama3	T	A	18: 12,577,840	V3144E	probably damaging	Het
Mark1	G	A	1: 184,912,589	S390L	possibly damaging	Het
Mbd3l1	T	C	9: 18,484,728	Y50H	probably benign	Het
Mcat	T	C	15: 83,549,182	N220S	probably benign	Het
Muc2	A	G	7: 141,696,698	E81G	probably benign	Het
Neto1	A	T	18: 86,494,860	K327*	probably null	Het
Olfr1200	A	T	2: 88,768,243	L24Q	probably damaging	Het
Olfr218	G	T	1: 173,204,280	R308L	probably benign	Het
Olfr654	T	C	7: 104,588,011	L69P	probably damaging	Het
Olfr656	A	T	7: 104,618,441	Y254F	probably damaging	Het
Pidd1	A	T	7: 141,439,581	V722D	probably damaging	Het
Ppp2r2a	G	T	14: 67,019,804	H326N	probably damaging	Het
Smarca5	G	A	8: 80,719,652	T473I	probably damaging	Het
Spg11	C	A	2: 122,092,292	W892L	probably damaging	Het
Tas2r110	T	A	6: 132,868,285	I93N	possibly damaging	Het
Tiam2	CGGG	CGGGG	17: 3,414,622		probably null	Het
Vmn1r71	T	A	7: 10,748,681	I27F	probably benign	Het
Vsnl1	A	G	12: 11,326,488	V132A	probably benign	Het
Wdsub1	T	C	2: 59,878,308	T74A	probably damaging	Het
Ywhaz	T	C	15: 36,790,922	Y19C	probably damaging	Het

Other mutations in Dscaml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Dscaml1	APN	9	45670200	nonsense	probably null
IGL00497:Dscaml1	APN	9	45752238	missense	probably damaging	1.00
IGL00895:Dscaml1	APN	9	45751253	missense	probably damaging	0.99
IGL01011:Dscaml1	APN	9	45683672	missense	possibly damaging	0.76
IGL01086:Dscaml1	APN	9	45702662	splice site	probably benign
IGL01125:Dscaml1	APN	9	45749632	critical splice acceptor site	probably null
IGL01132:Dscaml1	APN	9	45752328	nonsense	probably null
IGL01356:Dscaml1	APN	9	45746857	missense	probably benign	0.03
IGL01459:Dscaml1	APN	9	45742683	nonsense	probably null
IGL01552:Dscaml1	APN	9	45447908	missense	probably damaging	1.00
IGL02033:Dscaml1	APN	9	45683782	missense	probably damaging	1.00
IGL02044:Dscaml1	APN	9	45746943	nonsense	probably null
IGL02095:Dscaml1	APN	9	45447703	missense	probably damaging	1.00
IGL02166:Dscaml1	APN	9	45683701	missense	probably damaging	0.98
IGL02262:Dscaml1	APN	9	45745116	missense	probably benign
IGL02262:Dscaml1	APN	9	45732080	missense	probably benign	0.44
IGL02340:Dscaml1	APN	9	45670176	missense	possibly damaging	0.66
IGL02604:Dscaml1	APN	9	45744328	unclassified	probably benign
IGL02619:Dscaml1	APN	9	45447796	missense	probably damaging	1.00
IGL02805:Dscaml1	APN	9	45447897	missense	probably damaging	0.98
IGL03409:Dscaml1	APN	9	45670103	missense	probably damaging	1.00
D3080:Dscaml1	UTSW	9	45684325	missense	probably benign	0.44
IGL03050:Dscaml1	UTSW	9	45742999	missense	probably damaging	1.00
R0149:Dscaml1	UTSW	9	45742680	nonsense	probably null
R0582:Dscaml1	UTSW	9	45668264	missense	possibly damaging	0.77
R0629:Dscaml1	UTSW	9	45721418	missense	probably damaging	0.98
R0632:Dscaml1	UTSW	9	45732134	missense	probably benign	0.06
R0815:Dscaml1	UTSW	9	45745074	missense	probably benign	0.00
R1162:Dscaml1	UTSW	9	45752349	splice site	probably benign
R1449:Dscaml1	UTSW	9	45742223	missense	possibly damaging	0.95
R1474:Dscaml1	UTSW	9	45685221	missense	probably damaging	1.00
R1481:Dscaml1	UTSW	9	45672643	missense	probably benign	0.01
R1533:Dscaml1	UTSW	9	45450584	missense	probably damaging	0.99
R1542:Dscaml1	UTSW	9	45749440	missense	possibly damaging	0.84
R1572:Dscaml1	UTSW	9	45721333	missense	probably benign	0.00
R1627:Dscaml1	UTSW	9	45753147	missense	probably damaging	1.00
R1634:Dscaml1	UTSW	9	45672749	missense	probably damaging	1.00
R1713:Dscaml1	UTSW	9	45752690	missense	possibly damaging	0.49
R1777:Dscaml1	UTSW	9	45683756	missense	possibly damaging	0.58
R1812:Dscaml1	UTSW	9	45751286	critical splice donor site	probably null
R1834:Dscaml1	UTSW	9	45683632	missense	probably benign	0.00
R1907:Dscaml1	UTSW	9	45740480	missense	probably damaging	1.00
R1953:Dscaml1	UTSW	9	45670224	missense	probably benign	0.01
R2056:Dscaml1	UTSW	9	45750132	missense	probably damaging	0.99
R2193:Dscaml1	UTSW	9	45685234	missense	probably benign	0.21
R2497:Dscaml1	UTSW	9	45745078	missense	probably benign	0.00
R3768:Dscaml1	UTSW	9	45732137	missense	possibly damaging	0.94
R3891:Dscaml1	UTSW	9	45717484	missense	possibly damaging	0.84
R4110:Dscaml1	UTSW	9	45732068	missense	probably benign	0.07
R4706:Dscaml1	UTSW	9	45450580	missense	probably damaging	1.00
R4716:Dscaml1	UTSW	9	45450592	missense	probably damaging	1.00
R4719:Dscaml1	UTSW	9	45672695	missense	probably benign	0.13
R4770:Dscaml1	UTSW	9	45670106	missense	probably damaging	1.00
R4924:Dscaml1	UTSW	9	45745189	missense	probably damaging	1.00
R5167:Dscaml1	UTSW	9	45717432	missense	probably damaging	1.00
R5346:Dscaml1	UTSW	9	45450559	missense	possibly damaging	0.63
R5737:Dscaml1	UTSW	9	45745185	missense	probably damaging	0.99
R5977:Dscaml1	UTSW	9	45721298	missense	probably benign	0.19
R6073:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6276:Dscaml1	UTSW	9	45668160	missense	possibly damaging	0.62
R6415:Dscaml1	UTSW	9	45683677	nonsense	probably null
R6527:Dscaml1	UTSW	9	45712184	nonsense	probably null
R6655:Dscaml1	UTSW	9	45746937	missense	probably benign	0.00
R6772:Dscaml1	UTSW	9	45710311	missense	probably damaging	1.00
R6799:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6892:Dscaml1	UTSW	9	45683830	missense	probably damaging	0.99
R6918:Dscaml1	UTSW	9	45430507	missense	probably benign
R6967:Dscaml1	UTSW	9	45674523	missense	probably damaging	0.97
R7214:Dscaml1	UTSW	9	45670139	missense	probably benign	0.01
R7286:Dscaml1	UTSW	9	45742746	critical splice donor site	probably null
R7315:Dscaml1	UTSW	9	45745125	missense	probably benign	0.00
R7338:Dscaml1	UTSW	9	45674504	missense	probably benign	0.12
R7343:Dscaml1	UTSW	9	45752916	missense	probably benign
R7395:Dscaml1	UTSW	9	45702405	missense	possibly damaging	0.73
R7439:Dscaml1	UTSW	9	45710326	missense	possibly damaging	0.94
R7484:Dscaml1	UTSW	9	45749446	splice site	probably null
R7545:Dscaml1	UTSW	9	45685383	missense	probably benign	0.11
R7979:Dscaml1	UTSW	9	45683731	missense	probably damaging	1.00
R8005:Dscaml1	UTSW	9	45717510	missense	probably damaging	1.00
R8181:Dscaml1	UTSW	9	45746842	missense	possibly damaging	0.86
R8428:Dscaml1	UTSW	9	45742586	missense	probably benign	0.00
X0058:Dscaml1	UTSW	9	45752128	missense	probably benign	0.00
Z1177:Dscaml1	UTSW	9	45672791	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCAAATGACCGTGTTCCCAGG -3'
(R):5'- TTCGAGTAGTGAGTCCCTGG -3'

Sequencing Primer
(F):5'- GTGTTCCCAGGCTTCCAG -3'
(R):5'- AGTAGTGAGTCCCTGGAGCCC -3'

Posted On

2018-06-22