Incidental Mutation 'R6582:Vsnl1'
ID524176
Institutional Source Beutler Lab
Gene Symbol Vsnl1
Ensembl Gene ENSMUSG00000054459
Gene Namevisinin-like 1
SynonymsVILIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location11325242-11436613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11326488 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 132 (V132A)
Ref Sequence ENSEMBL: ENSMUSP00000152711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072299] [ENSMUST00000220506]
Predicted Effect probably benign
Transcript: ENSMUST00000072299
AA Change: V132A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000072145
Gene: ENSMUSG00000054459
AA Change: V132A

DomainStartEndE-ValueType
EFh 64 92 2.13e-5 SMART
EFh 100 128 5.24e-5 SMART
EFh 150 178 2.09e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220506
AA Change: V132A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.1476 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. The encoded protein is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Vsnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Vsnl1 APN 12 11332189 missense probably damaging 0.96
IGL02285:Vsnl1 APN 12 11386877 missense probably damaging 1.00
IGL02610:Vsnl1 APN 12 11332071 nonsense probably null
PIT4696001:Vsnl1 UTSW 12 11326447 missense probably benign 0.23
R0055:Vsnl1 UTSW 12 11386986 splice site probably null
R0598:Vsnl1 UTSW 12 11386859 missense probably benign
R0909:Vsnl1 UTSW 12 11326371 missense probably damaging 1.00
R1444:Vsnl1 UTSW 12 11332218 critical splice acceptor site probably null
R4256:Vsnl1 UTSW 12 11332055 nonsense probably null
R6315:Vsnl1 UTSW 12 11332155 missense probably damaging 1.00
R6489:Vsnl1 UTSW 12 11332218 critical splice acceptor site probably benign
R7422:Vsnl1 UTSW 12 11326438 missense probably benign 0.00
R7909:Vsnl1 UTSW 12 11326454 missense probably benign 0.00
R7919:Vsnl1 UTSW 12 11332086 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CAAGACTTGTGTGCAGTCCATAG -3'
(R):5'- GGTTGCCATGGGAACTTAGAAC -3'

Sequencing Primer
(F):5'- TGTGCAGTCCATAGCATCGAC -3'
(R):5'- TGCCATGGGAACTTAGAACTTGGG -3'
Posted On2018-06-22