Incidental Mutation 'R6582:Gzmk'
ID524178
Institutional Source Beutler Lab
Gene Symbol Gzmk
Ensembl Gene ENSMUSG00000042385
Gene Namegranzyme K
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location113171608-113225908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113180511 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 45 (Y45H)
Ref Sequence ENSEMBL: ENSMUSP00000114250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038212] [ENSMUST00000122399] [ENSMUST00000140324]
Predicted Effect probably damaging
Transcript: ENSMUST00000038212
AA Change: Y45H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044512
Gene: ENSMUSG00000042385
AA Change: Y45H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Tryp_SPc 25 253 2.12e-87 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122399
AA Change: Y6H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113530
Gene: ENSMUSG00000042385
AA Change: Y6H

DomainStartEndE-ValueType
Tryp_SPc 1 214 9.28e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140324
AA Change: Y45H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114250
Gene: ENSMUSG00000042385
AA Change: Y45H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Trypsin 26 69 1.2e-18 PFAM
Meta Mutation Damage Score 0.3076 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a group of related serine proteases from the cytoplasmic granules of cytotoxic lymphocytes. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here lacks consensus sequences for N-glycosylation present in other granzymes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Gzmk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Gzmk APN 13 113173124 missense probably benign 0.09
IGL01702:Gzmk APN 13 113180550 missense probably damaging 1.00
IGL02869:Gzmk APN 13 113172026 missense probably damaging 1.00
R1687:Gzmk UTSW 13 113173928 missense probably benign 0.32
R1813:Gzmk UTSW 13 113172893 missense probably damaging 1.00
R1896:Gzmk UTSW 13 113172893 missense probably damaging 1.00
R2113:Gzmk UTSW 13 113173955 missense probably benign 0.33
R2128:Gzmk UTSW 13 113172014 missense probably damaging 0.99
R2993:Gzmk UTSW 13 113180477 missense probably damaging 1.00
R3936:Gzmk UTSW 13 113173025 missense probably damaging 1.00
R4619:Gzmk UTSW 13 113173123 missense probably damaging 0.99
R4838:Gzmk UTSW 13 113173021 missense probably damaging 1.00
R5131:Gzmk UTSW 13 113173948 missense probably benign
R5892:Gzmk UTSW 13 113173922 critical splice donor site probably null
R7491:Gzmk UTSW 13 113172001 missense probably benign 0.36
R8027:Gzmk UTSW 13 113171900 nonsense probably null
R8145:Gzmk UTSW 13 113171896 missense probably damaging 1.00
X0025:Gzmk UTSW 13 113180833 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCGCCTTGGTTAATCTTACTGTAC -3'
(R):5'- TACAACTGCTAGCCGGAAAAG -3'

Sequencing Primer
(F):5'- ACTCACCAAGAGTAGCAG -3'
(R):5'- GGTACACTAAGTATTGAGCACCGTTG -3'
Posted On2018-06-22