Mutagenetix > Incidental Mutation

Incidental Mutation 'R6582:Ppp2r2a'

524186

Institutional Source

Beutler Lab

Gene Symbol

Ppp2r2a

Ensembl Gene

ENSMUSG00000022052

Gene Name

protein phosphatase 2, regulatory subunit B, alpha

Synonyms

2410004D02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6582 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67014056-67072444 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 67019804 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 326 (H326N)

Ref Sequence

ENSEMBL: ENSMUSP00000153191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089230] [ENSMUST00000225251] [ENSMUST00000225380]

AlphaFold

Q6P1F6

Predicted Effect

probably damaging
Transcript: ENSMUST00000089230
AA Change: H326N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000086640
Gene: ENSMUSG00000022052
AA Change: H326N

Domain	Start	End	E-Value	Type
WD40	21	56	1.33e1	SMART
WD40	83	123	6.88e0	SMART
WD40	165	204	2.3e0	SMART
WD40	215	255	8.88e0	SMART
WD40	274	312	5.11e1	SMART
WD40	339	370	1.42e2	SMART
WD40	406	443	2.47e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223630

Predicted Effect

probably benign
Transcript: ENSMUST00000225251

Predicted Effect

probably damaging
Transcript: ENSMUST00000225380
AA Change: H326N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225469

Meta Mutation Damage Score

0.8168

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,258,225	T2369A	probably benign	Het
Abhd6	G	T	14: 8,042,826	G128C	probably damaging	Het
Abhd6	T	G	14: 8,042,828		probably null	Het
Acsm3	A	G	7: 119,779,673	E426G	probably benign	Het
Ankrd11	T	C	8: 122,891,629	D1828G	probably benign	Het
Asmt	T	A	X: 170,675,031		probably null	Het
Casp4	A	G	9: 5,324,884	Q232R	probably benign	Het
Cenpt	A	T	8: 105,849,201	L171*	probably null	Het
Chd3	AGCGGCGGCGGCGGCGGCGG	AGCGGCGGCGGCGGCGG	11: 69,369,156		probably benign	Het
Col5a2	G	T	1: 45,390,115	H948N	possibly damaging	Het
Dnah9	G	T	11: 66,061,097	H1859N	probably damaging	Het
Dscaml1	G	A	9: 45,752,806	R1993Q	probably benign	Het
Fbxw8	C	A	5: 118,124,963	R217L	probably benign	Het
Flnb	T	G	14: 7,892,275		probably null	Het
Fyb2	A	G	4: 104,945,542	N214D	probably benign	Het
Gbp2b	A	G	3: 142,611,040	E484G	possibly damaging	Het
Gzmk	A	G	13: 113,180,511	Y45H	probably damaging	Het
Ivl	CCTGCTGCTGCTGCT	CCTGCTGCTGCT	3: 92,571,910		probably benign	Het
Kcnj6	A	G	16: 94,832,826	V142A	possibly damaging	Het
Klri2	A	T	6: 129,739,133	I81K	possibly damaging	Het
Lama3	T	A	18: 12,577,840	V3144E	probably damaging	Het
Mark1	G	A	1: 184,912,589	S390L	possibly damaging	Het
Mbd3l1	T	C	9: 18,484,728	Y50H	probably benign	Het
Mcat	T	C	15: 83,549,182	N220S	probably benign	Het
Muc2	A	G	7: 141,696,698	E81G	probably benign	Het
Neto1	A	T	18: 86,494,860	K327*	probably null	Het
Olfr1200	A	T	2: 88,768,243	L24Q	probably damaging	Het
Olfr218	G	T	1: 173,204,280	R308L	probably benign	Het
Olfr654	T	C	7: 104,588,011	L69P	probably damaging	Het
Olfr656	A	T	7: 104,618,441	Y254F	probably damaging	Het
Pidd1	A	T	7: 141,439,581	V722D	probably damaging	Het
Smarca5	G	A	8: 80,719,652	T473I	probably damaging	Het
Spg11	C	A	2: 122,092,292	W892L	probably damaging	Het
Tas2r110	T	A	6: 132,868,285	I93N	possibly damaging	Het
Tiam2	CGGG	CGGGG	17: 3,414,622		probably null	Het
Vmn1r71	T	A	7: 10,748,681	I27F	probably benign	Het
Vsnl1	A	G	12: 11,326,488	V132A	probably benign	Het
Wdsub1	T	C	2: 59,878,308	T74A	probably damaging	Het
Ywhaz	T	C	15: 36,790,922	Y19C	probably damaging	Het

Other mutations in Ppp2r2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01620:Ppp2r2a	APN	14	67070277	missense	probably damaging	0.96
IGL01997:Ppp2r2a	APN	14	67016519	missense	probably benign
IGL02024:Ppp2r2a	APN	14	67038912	missense	probably benign	0.06
IGL02178:Ppp2r2a	APN	14	67023097	missense	probably damaging	1.00
IGL03148:Ppp2r2a	APN	14	67022295	missense	probably benign	0.00
IGL03304:Ppp2r2a	APN	14	67016528	missense	probably benign	0.13
limber	UTSW	14	67019804	missense	probably damaging	1.00
R1216:Ppp2r2a	UTSW	14	67028998	nonsense	probably null
R1576:Ppp2r2a	UTSW	14	67038869	splice site	probably benign
R1629:Ppp2r2a	UTSW	14	67019759	missense	possibly damaging	0.93
R1662:Ppp2r2a	UTSW	14	67016603	missense	probably benign
R1808:Ppp2r2a	UTSW	14	67038963	missense	probably damaging	1.00
R1937:Ppp2r2a	UTSW	14	67016429	missense	possibly damaging	0.93
R2121:Ppp2r2a	UTSW	14	67023128	missense	probably damaging	1.00
R2134:Ppp2r2a	UTSW	14	67016475	missense	possibly damaging	0.63
R3150:Ppp2r2a	UTSW	14	67023765	missense	probably damaging	1.00
R3694:Ppp2r2a	UTSW	14	67019750	missense	probably damaging	1.00
R3695:Ppp2r2a	UTSW	14	67019750	missense	probably damaging	1.00
R3825:Ppp2r2a	UTSW	14	67022443	missense	probably damaging	0.98
R4031:Ppp2r2a	UTSW	14	67028976	missense	probably damaging	1.00
R4209:Ppp2r2a	UTSW	14	67028879	missense	probably damaging	1.00
R4353:Ppp2r2a	UTSW	14	67028937	missense	probably damaging	1.00
R4639:Ppp2r2a	UTSW	14	67038957	missense	probably damaging	1.00
R4976:Ppp2r2a	UTSW	14	67016637	missense	possibly damaging	0.71
R5001:Ppp2r2a	UTSW	14	67022308	nonsense	probably null
R5106:Ppp2r2a	UTSW	14	67023097	missense	probably damaging	1.00
R5322:Ppp2r2a	UTSW	14	67038873	critical splice donor site	probably null
R5360:Ppp2r2a	UTSW	14	67016571	nonsense	probably null
R5429:Ppp2r2a	UTSW	14	67023756	missense	probably damaging	1.00
R5439:Ppp2r2a	UTSW	14	67022323	missense	possibly damaging	0.70
R6250:Ppp2r2a	UTSW	14	67038954	missense	probably damaging	1.00
R8263:Ppp2r2a	UTSW	14	67023756	missense	probably damaging	1.00
R8315:Ppp2r2a	UTSW	14	67023728	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGGAAGAAAAGTGACTCTTAACTG -3'
(R):5'- TCTCAGGGTGCACTGCAATAC -3'

Sequencing Primer
(F):5'- AGAAAAGTGACTCTTAACTGCTTTC -3'
(R):5'- CACTGCAATACCCAGAAAGGTGG -3'

Posted On

2018-06-22