Incidental Mutation 'R6582:Ywhaz'
ID524188
Institutional Source Beutler Lab
Gene Symbol Ywhaz
Ensembl Gene ENSMUSG00000022285
Gene Nametyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Synonyms1110013I11Rik, 14-3-3 zeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.595) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location36770770-36796929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36790922 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 19 (Y19C)
Ref Sequence ENSEMBL: ENSMUSP00000120610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022894] [ENSMUST00000110359] [ENSMUST00000110361] [ENSMUST00000110362] [ENSMUST00000126184] [ENSMUST00000151635] [ENSMUST00000226851]
Predicted Effect probably damaging
Transcript: ENSMUST00000022894
AA Change: Y19C

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022894
Gene: ENSMUSG00000022285
AA Change: Y19C

DomainStartEndE-ValueType
14_3_3 3 242 1.25e-148 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110359
AA Change: Y19C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000110361
AA Change: Y19C

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105990
Gene: ENSMUSG00000022285
AA Change: Y19C

DomainStartEndE-ValueType
14_3_3 3 242 1.25e-148 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110362
AA Change: Y19C

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105991
Gene: ENSMUSG00000022285
AA Change: Y19C

DomainStartEndE-ValueType
14_3_3 3 242 1.25e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126184
AA Change: Y19C

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115928
Gene: ENSMUSG00000022285
AA Change: Y19C

DomainStartEndE-ValueType
14_3_3 3 88 2.26e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151635
AA Change: Y19C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154879
Predicted Effect probably damaging
Transcript: ENSMUST00000226851
AA Change: Y19C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227067
Meta Mutation Damage Score 0.9353 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse, rat and sheep orthologs. The encoded protein interacts with IRS1 protein, suggesting a role in regulating insulin sensitivity. Several transcript variants that differ in the 5' UTR but that encode the same protein have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation after P14, some postnatal lethality by P21. Mice homozygous for one gene trap allele also exhibit neurodevelopmental and neuropsychiatric behaviour defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Other mutations in Ywhaz
AlleleSourceChrCoordTypePredicted EffectPPH Score
Impecunious UTSW 15 36790922 missense probably damaging 1.00
R0559:Ywhaz UTSW 15 36790964 missense possibly damaging 0.80
R1291:Ywhaz UTSW 15 36772734 unclassified probably benign
R1705:Ywhaz UTSW 15 36790715 missense possibly damaging 0.55
R5810:Ywhaz UTSW 15 36775266 missense probably damaging 1.00
R6579:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6583:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6642:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6643:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
X0027:Ywhaz UTSW 15 36775556 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATCGTTGCAGATGTCACGC -3'
(R):5'- CTCAAGCTGGTTTGAGGTACTG -3'

Sequencing Primer
(F):5'- TTGCAGATGTCACGCAGCTC -3'
(R):5'- CTGGTTTGAGGTACTGGTGTGC -3'
Posted On2018-06-22