Incidental Mutation 'R6582:Mcat'
ID524190
Institutional Source Beutler Lab
Gene Symbol Mcat
Ensembl Gene ENSMUSG00000048755
Gene Namemalonyl CoA:ACP acyltransferase (mitochondrial)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location83546797-83563787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83549182 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 220 (N220S)
Ref Sequence ENSEMBL: ENSMUSP00000051569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016902] [ENSMUST00000061882] [ENSMUST00000229165] [ENSMUST00000229724] [ENSMUST00000229964] [ENSMUST00000230912]
Predicted Effect probably benign
Transcript: ENSMUST00000016902
SMART Domains Protein: ENSMUSP00000016902
Gene: ENSMUSG00000016758

DomainStartEndE-ValueType
Pfam:bcl-2I13 1 149 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061882
AA Change: N220S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000051569
Gene: ENSMUSG00000048755
AA Change: N220S

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:Acyl_transf_1 62 342 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229177
Predicted Effect probably benign
Transcript: ENSMUST00000229724
AA Change: N57S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000229964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230094
Predicted Effect probably benign
Transcript: ENSMUST00000230672
Predicted Effect probably benign
Transcript: ENSMUST00000230851
Predicted Effect probably benign
Transcript: ENSMUST00000230912
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found exclusively in the mitochondrion, where it catalyzes the transfer of a malonyl group from malonyl-CoA to the mitochondrial acyl carrier protein. The encoded protein may be part of a fatty acid synthase complex that is more like the type II prokaryotic and plastid complexes rather than the type I human cytosolic complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated ubiquitously consume more food, fail to gain weight, are less physically active, and suffer from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Mcat
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0569:Mcat UTSW 15 83549248 missense probably benign 0.00
R1497:Mcat UTSW 15 83549252 nonsense probably null
R5518:Mcat UTSW 15 83547674 splice site probably null
R5909:Mcat UTSW 15 83547915 missense probably benign 0.20
R6508:Mcat UTSW 15 83549251 missense probably benign
R6964:Mcat UTSW 15 83547931 unclassified probably benign
R7599:Mcat UTSW 15 83547671 missense probably damaging 1.00
R7814:Mcat UTSW 15 83547909 missense probably damaging 0.97
R8306:Mcat UTSW 15 83555391 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCTCAGACATGTTCTCCAG -3'
(R):5'- CTGTTTCCCTGAATGACAGCTTAC -3'

Sequencing Primer
(F):5'- GTTCTCCAGATGATACTCAGCAAGG -3'
(R):5'- GATTTCCAAACGAACCTCTATCTGG -3'
Posted On2018-06-22