Incidental Mutation 'R6582:Kcnj6'
ID524192
Institutional Source Beutler Lab
Gene Symbol Kcnj6
Ensembl Gene ENSMUSG00000043301
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 6
SynonymsKCNJ7, GIRK2, Kir3.2
MMRRC Submission
Accession Numbers

Genbank: NM_001025584.2, NM_001025585.2, NM_001025590.1, NM_010606.2  

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location94748636-94997701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94832826 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000093558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095873] [ENSMUST00000099508] [ENSMUST00000165538] [ENSMUST00000232562]
PDB Structure
Crystal Structure of the Cytoplasmic Domain of G-Protein-Gated Inward Rectifier Potassium Channel Kir3.2 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095873
AA Change: V142A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093558
Gene: ENSMUSG00000043301
AA Change: V142A

DomainStartEndE-ValueType
Pfam:IRK 59 397 9.3e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099508
AA Change: V142A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097108
Gene: ENSMUSG00000043301
AA Change: V142A

DomainStartEndE-ValueType
Pfam:IRK 59 382 8.5e-146 PFAM
low complexity region 396 411 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165538
AA Change: V124A

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130321
Gene: ENSMUSG00000043301
AA Change: V124A

DomainStartEndE-ValueType
Pfam:IRK 41 302 5.3e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232403
Predicted Effect probably benign
Transcript: ENSMUST00000232562
AA Change: V124A

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
Meta Mutation Damage Score 0.2347 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled inwardly-rectifying potassium channel family of inward rectifier potassium channels. This type of potassium channel allows a greater flow of potassium into the cell than out of it. These proteins modulate many physiological processes, including heart rate in cardiac cells and circuit activity in neuronal cells, through G-protein coupled receptor stimulation. Mutations in this gene are associated with Keppen-Lubinsky Syndrome, a rare condition characterized by severe developmental delay, facial dysmorphism, and intellectual disability. [provided by RefSeq, Apr 2015]
PHENOTYPE: A spontaneous mutation exhibits small size, ataxia, hypotonia, high periweaning mortality, Purkinje cell defects, and male sterility. Homozygotes for a targeted null mutation exhibit increased susceptibility to spontaneous and drug-induced seizures. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(1) Spontaneous(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Kcnj6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Kcnj6 APN 16 94832455 missense probably damaging 0.99
IGL01433:Kcnj6 APN 16 94832955 missense probably benign 0.21
IGL01603:Kcnj6 APN 16 94833199 missense probably benign 0.00
IGL02212:Kcnj6 APN 16 94832487 missense probably damaging 1.00
IGL02982:Kcnj6 APN 16 94832517 missense possibly damaging 0.89
IGL03351:Kcnj6 APN 16 94832583 missense probably damaging 1.00
Seizure UTSW 16 94832659 missense probably damaging 1.00
H8477:Kcnj6 UTSW 16 94832937 missense probably damaging 1.00
IGL02796:Kcnj6 UTSW 16 94832919 missense probably benign 0.00
R0070:Kcnj6 UTSW 16 94941197 missense probably benign
R1558:Kcnj6 UTSW 16 94762499 missense possibly damaging 0.57
R1676:Kcnj6 UTSW 16 94832584 missense probably damaging 1.00
R2435:Kcnj6 UTSW 16 94762679 missense probably damaging 0.99
R3700:Kcnj6 UTSW 16 94833006 missense probably damaging 0.96
R3800:Kcnj6 UTSW 16 94833027 missense probably damaging 1.00
R4012:Kcnj6 UTSW 16 94825018 splice site probably null
R4899:Kcnj6 UTSW 16 94832613 missense probably damaging 1.00
R5124:Kcnj6 UTSW 16 94832659 missense probably damaging 1.00
R5359:Kcnj6 UTSW 16 94832453 nonsense probably null
R5560:Kcnj6 UTSW 16 94832965 missense probably benign 0.06
R5583:Kcnj6 UTSW 16 94833201 missense probably benign 0.26
R6057:Kcnj6 UTSW 16 94832377 missense probably damaging 1.00
R6330:Kcnj6 UTSW 16 94762601 missense possibly damaging 0.93
R6604:Kcnj6 UTSW 16 94762645 missense probably damaging 1.00
R6802:Kcnj6 UTSW 16 94762577 missense probably benign 0.06
R6866:Kcnj6 UTSW 16 94762677 missense probably damaging 1.00
R7304:Kcnj6 UTSW 16 94941183 missense probably benign
R7337:Kcnj6 UTSW 16 94833214 missense probably benign 0.10
R7396:Kcnj6 UTSW 16 94762447 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AAGCACAGTTTCCCATCCCG -3'
(R):5'- TGACGGACATCTTCACCAC -3'

Sequencing Primer
(F):5'- ATGGAGATCACCGCGTGG -3'
(R):5'- ACCCTGGTGGACCTGAAGTG -3'
Posted On2018-06-22