Incidental Mutation 'R6618:Fam166a'
ID524193
Institutional Source Beutler Lab
Gene Symbol Fam166a
Ensembl Gene ENSMUSG00000026969
Gene Namefamily with sequence similarity 166, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6618 (G1)
Quality Score124.008
Status Validated
Chromosome2
Chromosomal Location25218745-25222280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25220623 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 148 (L148M)
Ref Sequence ENSEMBL: ENSMUSP00000028346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028346] [ENSMUST00000043584]
Predicted Effect probably benign
Transcript: ENSMUST00000028346
AA Change: L148M

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028346
Gene: ENSMUSG00000026969
AA Change: L148M

DomainStartEndE-ValueType
Pfam:DUF2475 13 71 8.1e-16 PFAM
low complexity region 130 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043584
SMART Domains Protein: ENSMUSP00000042342
Gene: ENSMUSG00000036752

DomainStartEndE-ValueType
Tubulin 47 244 1.04e-67 SMART
Tubulin_C 246 383 3.89e-49 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145607
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1b2 T C 11: 69,603,463 D68G probably damaging Het
Barx2 G A 9: 31,846,872 L257F probably benign Het
Bbx C G 16: 50,266,263 W90S probably damaging Het
Bmp1 T A 14: 70,491,368 D588V probably damaging Het
Caskin2 C T 11: 115,800,029 M1188I possibly damaging Het
Ccdc180 T A 4: 45,950,708 I1651N probably damaging Het
Cr2 T C 1: 195,157,379 D580G probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Fam204a T C 19: 60,220,637 probably null Het
Fam71b A G 11: 46,407,299 T477A probably damaging Het
Fam83h T C 15: 76,003,511 D659G probably damaging Het
Hells G T 19: 38,957,084 R589L probably benign Het
Helz A G 11: 107,599,150 T144A probably benign Het
Il1r1 T A 1: 40,300,811 V258D probably damaging Het
Isoc2a A T 7: 4,895,326 I183F probably benign Het
Kat2a G T 11: 100,712,370 probably benign Het
Klf9 A G 19: 23,164,871 M232V probably benign Het
Lars G T 18: 42,244,908 S147R possibly damaging Het
Mfsd7a G T 5: 108,443,098 T400K probably benign Het
Mkrn3 A G 7: 62,419,033 F337L probably benign Het
Mrc2 A T 11: 105,349,882 N1466I probably damaging Het
Myo5c G A 9: 75,275,637 probably null Het
Pigs T C 11: 78,341,230 L396P probably damaging Het
Prkcb G A 7: 122,627,663 R624Q probably benign Het
R3hdm1 T C 1: 128,193,565 S269P probably benign Het
Racgap1 A T 15: 99,623,994 I505K probably damaging Het
Ralgds T A 2: 28,550,511 D777E probably benign Het
Rdh14 A G 12: 10,395,123 I325V probably benign Het
Rpn2 T A 2: 157,321,861 H624Q probably benign Het
Scarb1 C T 5: 125,304,330 S50N probably damaging Het
Shmt1 T C 11: 60,792,946 probably null Het
Smim24 A G 10: 81,394,132 N27S possibly damaging Het
Snx13 A G 12: 35,112,445 D550G probably damaging Het
Tnfsf18 T A 1: 161,494,780 L23* probably null Het
Trpc3 T A 3: 36,640,695 K703N possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Zfy2 A G Y: 2,121,477 S139P probably benign Homo
Other mutations in Fam166a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Fam166a APN 2 25220333 missense possibly damaging 0.90
IGL01712:Fam166a APN 2 25218792 unclassified probably benign
IGL03056:Fam166a APN 2 25221355 missense possibly damaging 0.73
IGL03232:Fam166a APN 2 25221739 nonsense probably null
R0368:Fam166a UTSW 2 25220673 missense probably benign
R0761:Fam166a UTSW 2 25220123 unclassified probably benign
R1997:Fam166a UTSW 2 25220205 missense probably damaging 1.00
R2106:Fam166a UTSW 2 25220651 missense probably damaging 0.99
R4575:Fam166a UTSW 2 25220288 missense probably benign 0.00
R4576:Fam166a UTSW 2 25220288 missense probably benign 0.00
R4577:Fam166a UTSW 2 25220288 missense probably benign 0.00
R4578:Fam166a UTSW 2 25220288 missense probably benign 0.00
R5829:Fam166a UTSW 2 25218857 critical splice donor site probably null
R5896:Fam166a UTSW 2 25220566 missense probably benign
R6905:Fam166a UTSW 2 25220479 missense probably benign 0.00
R7178:Fam166a UTSW 2 25220240 missense probably damaging 0.99
R7636:Fam166a UTSW 2 25218820 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCCCTACATGGCTCAAGG -3'
(R):5'- TGCAGTGGTATAGCTGGGAC -3'

Sequencing Primer
(F):5'- TACATGGCTCAAGGGCTACC -3'
(R):5'- CTGGGACAAGGAAGTGCAAATTACC -3'
Posted On2018-06-22