Mutagenetix > Incidental Mutations

Incidental Mutation 'R6618:Ralgds'

524195

Institutional Source

Beutler Lab

Gene Symbol

Ralgds

Ensembl Gene

ENSMUSG00000026821

Gene Name

ral guanine nucleotide dissociation stimulator

Synonyms

RalGDS, Gnds, Rgds

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001145835.1, NM_001145836.1, NM_009058.2, NM_001145834.1; MGI:107485

Is this an essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R6618 (G1)

Quality Score

182.009

Status

Validated

Chromosome

Chromosomal Location

28513125-28553081 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 28550511 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 777 (D777E)

Ref Sequence

ENSEMBL: ENSMUSP00000028170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000140704]

Predicted Effect

probably benign
Transcript: ENSMUST00000028170
AA Change: D777E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821
AA Change: D777E

Domain	Start	End	E-Value	Type
RasGEFN	56	194	4.02e-37	SMART
low complexity region	239	285	N/A	INTRINSIC
RasGEF	320	587	5.28e-118	SMART
low complexity region	613	626	N/A	INTRINSIC
low complexity region	646	655	N/A	INTRINSIC
low complexity region	683	712	N/A	INTRINSIC
low complexity region	716	726	N/A	INTRINSIC
RA	736	823	6.51e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100241
AA Change: D832E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821
AA Change: D832E

Domain	Start	End	E-Value	Type
RasGEFN	111	249	4.02e-37	SMART
low complexity region	294	340	N/A	INTRINSIC
RasGEF	375	642	5.28e-118	SMART
low complexity region	668	681	N/A	INTRINSIC
low complexity region	701	710	N/A	INTRINSIC
low complexity region	738	767	N/A	INTRINSIC
low complexity region	771	781	N/A	INTRINSIC
RA	791	878	6.51e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113893
AA Change: D820E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821
AA Change: D820E

Domain	Start	End	E-Value	Type
RasGEFN	111	237	1.25e-42	SMART
low complexity region	282	328	N/A	INTRINSIC
RasGEF	363	630	5.28e-118	SMART
low complexity region	656	669	N/A	INTRINSIC
low complexity region	689	698	N/A	INTRINSIC
low complexity region	726	755	N/A	INTRINSIC
low complexity region	759	769	N/A	INTRINSIC
RA	779	866	6.51e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128680

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130281

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137513

Predicted Effect

probably benign
Transcript: ENSMUST00000140704
AA Change: D77E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000118966
Gene: ENSMUSG00000026821
AA Change: D77E

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
RA	36	123	6.51e-22	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

100% (37/37)

MGI Phenotype

Strain: 3574574
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide dissociation stimulators (GDSs, or exchange factors), such as RALGDS, are effectors of Ras-related GTPases (see MIM 190020) that participate in signaling for a variety of cellular processes.[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous mutant mice exhibit reduced tumor incidence, size and progression to malignancy in multistage skin carcinogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp1b2	T	C	11: 69,603,463	D68G	probably damaging	Het
Barx2	G	A	9: 31,846,872	L257F	probably benign	Het
Bbx	C	G	16: 50,266,263	W90S	probably damaging	Het
Bmp1	T	A	14: 70,491,368	D588V	probably damaging	Het
Caskin2	C	T	11: 115,800,029	M1188I	possibly damaging	Het
Ccdc180	T	A	4: 45,950,708	I1651N	probably damaging	Het
Cr2	T	C	1: 195,157,379	D580G	probably damaging	Het
Crebbp	C	T	16: 4,119,806	A698T	possibly damaging	Het
Fam166a	C	A	2: 25,220,623	L148M	probably benign	Het
Fam204a	T	C	19: 60,220,637		probably null	Het
Fam71b	A	G	11: 46,407,299	T477A	probably damaging	Het
Fam83h	T	C	15: 76,003,511	D659G	probably damaging	Het
Hells	G	T	19: 38,957,084	R589L	probably benign	Het
Helz	A	G	11: 107,599,150	T144A	probably benign	Het
Il1r1	T	A	1: 40,300,811	V258D	probably damaging	Het
Isoc2a	A	T	7: 4,895,326	I183F	probably benign	Het
Kat2a	G	T	11: 100,712,370		probably benign	Het
Klf9	A	G	19: 23,164,871	M232V	probably benign	Het
Lars	G	T	18: 42,244,908	S147R	possibly damaging	Het
Mfsd7a	G	T	5: 108,443,098	T400K	probably benign	Het
Mkrn3	A	G	7: 62,419,033	F337L	probably benign	Het
Mrc2	A	T	11: 105,349,882	N1466I	probably damaging	Het
Myo5c	G	A	9: 75,275,637		probably null	Het
Pigs	T	C	11: 78,341,230	L396P	probably damaging	Het
Prkcb	G	A	7: 122,627,663	R624Q	probably benign	Het
R3hdm1	T	C	1: 128,193,565	S269P	probably benign	Het
Racgap1	A	T	15: 99,623,994	I505K	probably damaging	Het
Rdh14	A	G	12: 10,395,123	I325V	probably benign	Het
Rpn2	T	A	2: 157,321,861	H624Q	probably benign	Het
Scarb1	C	T	5: 125,304,330	S50N	probably damaging	Het
Shmt1	T	C	11: 60,792,946		probably null	Het
Smim24	A	G	10: 81,394,132	N27S	possibly damaging	Het
Snx13	A	G	12: 35,112,445	D550G	probably damaging	Het
Tnfsf18	T	A	1: 161,494,780	L23*	probably null	Het
Trpc3	T	A	3: 36,640,695	K703N	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Zfy2	A	G	Y: 2,121,477	S139P	probably benign	Homo

Other mutations in Ralgds

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Ralgds	APN	2	28552218	missense	probably damaging	1.00
IGL01774:Ralgds	APN	2	28550542	nonsense	probably null
IGL02747:Ralgds	APN	2	28548110	unclassified	probably benign
IGL03135:Ralgds	APN	2	28549088	missense	probably damaging	0.99
PIT4458001:Ralgds	UTSW	2	28542474	missense	probably damaging	1.00
PIT4531001:Ralgds	UTSW	2	28545214	nonsense	probably null
R0049:Ralgds	UTSW	2	28542379	synonymous	silent
R0052:Ralgds	UTSW	2	28544388	critical splice donor site	probably null
R0052:Ralgds	UTSW	2	28544388	critical splice donor site	probably null
R0285:Ralgds	UTSW	2	28550569	splice site	probably null
R0665:Ralgds	UTSW	2	28545206	missense	probably damaging	0.98
R0718:Ralgds	UTSW	2	28549116	missense	probably benign	0.37
R1755:Ralgds	UTSW	2	28550546	missense	probably damaging	0.99
R1966:Ralgds	UTSW	2	28545875	missense	probably damaging	0.96
R2873:Ralgds	UTSW	2	28548769	splice site	probably null
R2874:Ralgds	UTSW	2	28548769	splice site	probably null
R4082:Ralgds	UTSW	2	28552271	utr 3 prime	probably benign
R4342:Ralgds	UTSW	2	28552095	missense	probably damaging	1.00
R4344:Ralgds	UTSW	2	28552095	missense	probably damaging	1.00
R4647:Ralgds	UTSW	2	28545520	critical splice donor site	probably null
R4738:Ralgds	UTSW	2	28545416	missense	probably damaging	1.00
R4762:Ralgds	UTSW	2	28552152	missense	probably damaging	0.97
R5027:Ralgds	UTSW	2	28552090	critical splice acceptor site	probably null
R5320:Ralgds	UTSW	2	28545212	missense	probably damaging	1.00
R5738:Ralgds	UTSW	2	28542526	intron	probably benign
R5969:Ralgds	UTSW	2	28542414	missense	probably damaging	1.00
R6014:Ralgds	UTSW	2	28543661	missense	probably damaging	0.97
R6136:Ralgds	UTSW	2	28550565	critical splice donor site	probably null
R6137:Ralgds	UTSW	2	28547588	missense	probably damaging	0.99
R6583:Ralgds	UTSW	2	28533644	missense	probably damaging	0.99
R6801:Ralgds	UTSW	2	28548436	missense	probably damaging	1.00
R7046:Ralgds	UTSW	2	28540729	missense	probably damaging	1.00
R7095:Ralgds	UTSW	2	28549308	missense	possibly damaging	0.83
R7276:Ralgds	UTSW	2	28545872	missense	probably damaging	1.00
R7399:Ralgds	UTSW	2	28543655	missense	possibly damaging	0.95
R7446:Ralgds	UTSW	2	28545889	missense	probably damaging	0.99
R7560:Ralgds	UTSW	2	28547595	missense	probably damaging	1.00
X0028:Ralgds	UTSW	2	28548699	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCTTCAGGGGCACATAG -3'
(R):5'- AGCATTCTTCCTGAAGTACCTGC -3'

Sequencing Primer
(F):5'- TAGCTCCCCAAGACCATGTGG -3'
(R):5'- AACCAGGCAATGTCCTCTCTG -3'

Posted On

2018-06-22