Incidental Mutation 'R6582:Neto1'
Institutional Source Beutler Lab
Gene Symbol Neto1
Ensembl Gene ENSMUSG00000050321
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6582 (G1)
Quality Score225.009
Status Validated
Chromosomal Location86394952-86501897 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86494860 bp
Amino Acid Change Lysine to Stop codon at position 327 (K327*)
Ref Sequence ENSEMBL: ENSMUSP00000057340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058829]
Predicted Effect probably null
Transcript: ENSMUST00000058829
AA Change: K327*
SMART Domains Protein: ENSMUSP00000057340
Gene: ENSMUSG00000050321
AA Change: K327*

signal peptide 1 22 N/A INTRINSIC
CUB 41 155 2.06e-35 SMART
CUB 172 287 3.1e-7 SMART
LDLa 291 328 3.11e-3 SMART
transmembrane domain 341 363 N/A INTRINSIC
low complexity region 485 497 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in mice encodes a protein that plays a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit depressed long term potentiation, reduced NMDAR excitatory postsynaptic potentiation, and decreased spartial learning and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Asmt T A X: 170,675,031 probably null Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Neto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Neto1 APN 18 86498812 missense probably damaging 0.98
IGL01505:Neto1 APN 18 86473689 missense possibly damaging 0.82
IGL01511:Neto1 APN 18 86395908 missense possibly damaging 0.96
IGL02704:Neto1 APN 18 86473823 missense probably damaging 1.00
IGL03072:Neto1 APN 18 86498589 missense probably benign 0.23
R0119:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0136:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0299:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0603:Neto1 UTSW 18 86473660 missense possibly damaging 0.95
R0633:Neto1 UTSW 18 86404729 nonsense probably null
R0657:Neto1 UTSW 18 86461320 missense probably benign 0.17
R1395:Neto1 UTSW 18 86398019 splice site probably benign
R1648:Neto1 UTSW 18 86500054 missense probably damaging 1.00
R1852:Neto1 UTSW 18 86395884 start codon destroyed probably null 0.53
R2249:Neto1 UTSW 18 86461274 missense probably benign 0.02
R4418:Neto1 UTSW 18 86404856 missense probably benign
R4476:Neto1 UTSW 18 86404673 missense probably damaging 0.98
R4676:Neto1 UTSW 18 86398302 missense possibly damaging 0.47
R5095:Neto1 UTSW 18 86398281 missense probably benign
R5282:Neto1 UTSW 18 86404873 missense probably damaging 1.00
R5337:Neto1 UTSW 18 86398309 missense probably benign 0.00
R5400:Neto1 UTSW 18 86395908 missense possibly damaging 0.86
R5435:Neto1 UTSW 18 86398263 missense probably benign 0.00
R5632:Neto1 UTSW 18 86498643 missense probably benign 0.00
R5755:Neto1 UTSW 18 86499094 missense probably damaging 0.99
R6272:Neto1 UTSW 18 86494815 missense probably damaging 1.00
R6486:Neto1 UTSW 18 86461246 missense probably benign
R6505:Neto1 UTSW 18 86498574 missense possibly damaging 0.81
R6526:Neto1 UTSW 18 86498748 missense possibly damaging 0.47
R6887:Neto1 UTSW 18 86498635 missense probably benign 0.16
R7452:Neto1 UTSW 18 86498931 missense probably benign
R7469:Neto1 UTSW 18 86498688 missense probably benign
R7795:Neto1 UTSW 18 86461073 missense probably benign 0.00
R8912:Neto1 UTSW 18 86461048 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-06-22