Incidental Mutation 'R6582:Asmt'
ID524200
Institutional Source Beutler Lab
Gene Symbol Asmt
Ensembl Gene ENSMUSG00000093806
Gene Nameacetylserotonin O-methyltransferase
SynonymsHiomt
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6582 (G1)
Quality Score129.339
Status Validated
ChromosomeX
Chromosomal Location170672644-170678054 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 170675031 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178693]
Predicted Effect probably null
Transcript: ENSMUST00000178693
SMART Domains Protein: ENSMUSP00000137135
Gene: ENSMUSG00000093806

DomainStartEndE-ValueType
Pfam:Dimerisation2 17 106 1.1e-29 PFAM
Pfam:Methyltransf_2 111 343 2.8e-82 PFAM
Pfam:Methyltransf_11 190 292 2.8e-8 PFAM
low complexity region 351 371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene belongs to the methyltransferase superfamily and is located in the pseudoautosomal region (PAR) of the X and Y chromosomes. The encoded enzyme catalyzes the final reaction in the synthesis of melatonin and is abundant in the pineal gland. Two amino acid substitutions (R78G and R242C) are present in the encoded protein derived from the reference strain, C57BL/6J, and this protein shows low enzyme activity relative to the protein derived from other strains. [provided by RefSeq, May 2015]
PHENOTYPE: Pineal melatonin synthesis requires enzymes encoded by Asmt and Aanat. C57BL/6, BALB/c, AKR/J, NZB/Bl, IS/Cam, and CAST/Ei carry the a allele of Asmt and lack melatonin. SK/Cam, SF/Cam, PERU, and FDS carry the b allele and have normal melatonin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,225 T2369A probably benign Het
Abhd6 G T 14: 8,042,826 G128C probably damaging Het
Abhd6 T G 14: 8,042,828 probably null Het
Acsm3 A G 7: 119,779,673 E426G probably benign Het
Ankrd11 T C 8: 122,891,629 D1828G probably benign Het
Casp4 A G 9: 5,324,884 Q232R probably benign Het
Cenpt A T 8: 105,849,201 L171* probably null Het
Chd3 AGCGGCGGCGGCGGCGGCGG AGCGGCGGCGGCGGCGG 11: 69,369,156 probably benign Het
Col5a2 G T 1: 45,390,115 H948N possibly damaging Het
Dnah9 G T 11: 66,061,097 H1859N probably damaging Het
Dscaml1 G A 9: 45,752,806 R1993Q probably benign Het
Fbxw8 C A 5: 118,124,963 R217L probably benign Het
Flnb T G 14: 7,892,275 probably null Het
Fyb2 A G 4: 104,945,542 N214D probably benign Het
Gbp2b A G 3: 142,611,040 E484G possibly damaging Het
Gzmk A G 13: 113,180,511 Y45H probably damaging Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kcnj6 A G 16: 94,832,826 V142A possibly damaging Het
Klri2 A T 6: 129,739,133 I81K possibly damaging Het
Lama3 T A 18: 12,577,840 V3144E probably damaging Het
Mark1 G A 1: 184,912,589 S390L possibly damaging Het
Mbd3l1 T C 9: 18,484,728 Y50H probably benign Het
Mcat T C 15: 83,549,182 N220S probably benign Het
Muc2 A G 7: 141,696,698 E81G probably benign Het
Neto1 A T 18: 86,494,860 K327* probably null Het
Olfr1200 A T 2: 88,768,243 L24Q probably damaging Het
Olfr218 G T 1: 173,204,280 R308L probably benign Het
Olfr654 T C 7: 104,588,011 L69P probably damaging Het
Olfr656 A T 7: 104,618,441 Y254F probably damaging Het
Pidd1 A T 7: 141,439,581 V722D probably damaging Het
Ppp2r2a G T 14: 67,019,804 H326N probably damaging Het
Smarca5 G A 8: 80,719,652 T473I probably damaging Het
Spg11 C A 2: 122,092,292 W892L probably damaging Het
Tas2r110 T A 6: 132,868,285 I93N possibly damaging Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Vmn1r71 T A 7: 10,748,681 I27F probably benign Het
Vsnl1 A G 12: 11,326,488 V132A probably benign Het
Wdsub1 T C 2: 59,878,308 T74A probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Asmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1634:Asmt UTSW X 170675829 missense probably damaging 1.00
R1809:Asmt UTSW X 170675745 splice site probably benign
R1994:Asmt UTSW X 170675789 missense possibly damaging 0.83
R4454:Asmt UTSW X 170672721 missense probably benign 0.01
R4546:Asmt UTSW X 170676495 critical splice donor site probably null
R4567:Asmt UTSW X 170676526 splice site probably null
R4889:Asmt UTSW X 170677029 missense possibly damaging 0.84
R5601:Asmt UTSW X 170676392 missense probably damaging 0.98
R5687:Asmt UTSW X 170678016 missense unknown
R6145:Asmt UTSW X 170674663 missense probably damaging 0.96
R6151:Asmt UTSW X 170676467 missense possibly damaging 0.92
R6752:Asmt UTSW X 170676361 missense probably benign 0.02
R7737:Asmt UTSW X 170676440 missense probably damaging 0.98
R8272:Asmt UTSW X 170672725 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCACCCTCAGCTTAGTGAAG -3'
(R):5'- CACTTCCTGCACCAATGATG -3'

Sequencing Primer
(F):5'- TTAGTGAAGCCCCGCCCAC -3'
(R):5'- GCACCAATGATGTCATTTCCTG -3'
Posted On2018-06-22