Incidental Mutation 'R6618:Fam71b'
ID524216
Institutional Source Beutler Lab
Gene Symbol Fam71b
Ensembl Gene ENSMUSG00000020401
Gene Namefamily with sequence similarity 71, member B
SynonymsOTTMUSG00000005491
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6618 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46396559-46407982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46407299 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 477 (T477A)
Ref Sequence ENSEMBL: ENSMUSP00000055079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063166]
Predicted Effect probably damaging
Transcript: ENSMUST00000063166
AA Change: T477A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055079
Gene: ENSMUSG00000020401
AA Change: T477A

DomainStartEndE-ValueType
Pfam:DUF3699 120 192 1.2e-32 PFAM
low complexity region 241 361 N/A INTRINSIC
low complexity region 497 523 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
SCOP:d1g7sa3 586 650 1e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139280
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1b2 T C 11: 69,603,463 D68G probably damaging Het
Barx2 G A 9: 31,846,872 L257F probably benign Het
Bbx C G 16: 50,266,263 W90S probably damaging Het
Bmp1 T A 14: 70,491,368 D588V probably damaging Het
Caskin2 C T 11: 115,800,029 M1188I possibly damaging Het
Ccdc180 T A 4: 45,950,708 I1651N probably damaging Het
Cr2 T C 1: 195,157,379 D580G probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Fam166a C A 2: 25,220,623 L148M probably benign Het
Fam204a T C 19: 60,220,637 probably null Het
Fam83h T C 15: 76,003,511 D659G probably damaging Het
Hells G T 19: 38,957,084 R589L probably benign Het
Helz A G 11: 107,599,150 T144A probably benign Het
Il1r1 T A 1: 40,300,811 V258D probably damaging Het
Isoc2a A T 7: 4,895,326 I183F probably benign Het
Kat2a G T 11: 100,712,370 probably benign Het
Klf9 A G 19: 23,164,871 M232V probably benign Het
Lars G T 18: 42,244,908 S147R possibly damaging Het
Mfsd7a G T 5: 108,443,098 T400K probably benign Het
Mkrn3 A G 7: 62,419,033 F337L probably benign Het
Mrc2 A T 11: 105,349,882 N1466I probably damaging Het
Myo5c G A 9: 75,275,637 probably null Het
Pigs T C 11: 78,341,230 L396P probably damaging Het
Prkcb G A 7: 122,627,663 R624Q probably benign Het
R3hdm1 T C 1: 128,193,565 S269P probably benign Het
Racgap1 A T 15: 99,623,994 I505K probably damaging Het
Ralgds T A 2: 28,550,511 D777E probably benign Het
Rdh14 A G 12: 10,395,123 I325V probably benign Het
Rpn2 T A 2: 157,321,861 H624Q probably benign Het
Scarb1 C T 5: 125,304,330 S50N probably damaging Het
Shmt1 T C 11: 60,792,946 probably null Het
Smim24 A G 10: 81,394,132 N27S possibly damaging Het
Snx13 A G 12: 35,112,445 D550G probably damaging Het
Tnfsf18 T A 1: 161,494,780 L23* probably null Het
Trpc3 T A 3: 36,640,695 K703N possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Zfy2 A G Y: 2,121,477 S139P probably benign Homo
Other mutations in Fam71b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Fam71b APN 11 46405397 nonsense probably null
IGL02375:Fam71b APN 11 46406552 missense probably damaging 0.99
IGL02571:Fam71b APN 11 46405245 missense probably damaging 0.99
R0013:Fam71b UTSW 11 46406804 missense unknown
R1902:Fam71b UTSW 11 46407011 missense probably benign 0.44
R1985:Fam71b UTSW 11 46407866 makesense probably null
R2079:Fam71b UTSW 11 46405107 missense probably benign 0.14
R2151:Fam71b UTSW 11 46405331 nonsense probably null
R2857:Fam71b UTSW 11 46405212 missense probably damaging 1.00
R2859:Fam71b UTSW 11 46405212 missense probably damaging 1.00
R3807:Fam71b UTSW 11 46404953 missense possibly damaging 0.77
R4232:Fam71b UTSW 11 46407405 missense possibly damaging 0.51
R4342:Fam71b UTSW 11 46407216 missense possibly damaging 0.67
R4679:Fam71b UTSW 11 46404813 missense possibly damaging 0.68
R5119:Fam71b UTSW 11 46407036 missense probably damaging 1.00
R5207:Fam71b UTSW 11 46405163 missense probably benign 0.13
R5540:Fam71b UTSW 11 46404888 missense probably damaging 0.99
R6862:Fam71b UTSW 11 46407591 missense possibly damaging 0.78
R7036:Fam71b UTSW 11 46407408 missense
R7489:Fam71b UTSW 11 46407441 missense
Z1088:Fam71b UTSW 11 46407723 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCACTTGCTGCAAACATCAC -3'
(R):5'- TCCCAGATACAGACCGGTAG -3'

Sequencing Primer
(F):5'- CCTTAGAAAATGTAGACGTGGCCTTG -3'
(R):5'- TACAGACCGGTAGGAAGATGTTTTCC -3'
Posted On2018-06-22