Incidental Mutation 'R6583:Samd11'
ID524220
Institutional Source Beutler Lab
Gene Symbol Samd11
Ensembl Gene ENSMUSG00000096351
Gene Namesterile alpha motif domain containing 11
Synonymsmr-s
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6583 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location156246966-156255657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156248134 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 446 (N446I)
Ref Sequence ENSEMBL: ENSMUSP00000151442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179543] [ENSMUST00000179886] [ENSMUST00000179919] [ENSMUST00000217934] [ENSMUST00000218788] [ENSMUST00000219393] [ENSMUST00000220228]
Predicted Effect probably benign
Transcript: ENSMUST00000179543
SMART Domains Protein: ENSMUSP00000137253
Gene: ENSMUSG00000095567

DomainStartEndE-ValueType
low complexity region 21 58 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 121 139 N/A INTRINSIC
Pfam:Noc2 331 626 1.8e-128 PFAM
low complexity region 651 675 N/A INTRINSIC
low complexity region 701 723 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179886
SMART Domains Protein: ENSMUSP00000137183
Gene: ENSMUSG00000095567

DomainStartEndE-ValueType
Pfam:Noc2 172 470 1.2e-117 PFAM
low complexity region 494 518 N/A INTRINSIC
low complexity region 544 566 N/A INTRINSIC
low complexity region 581 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179919
AA Change: N456I

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136611
Gene: ENSMUSG00000096351
AA Change: N456I

DomainStartEndE-ValueType
low complexity region 277 295 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
SAM 411 478 1.82e-6 SMART
low complexity region 486 503 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217934
AA Change: N446I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218230
Predicted Effect possibly damaging
Transcript: ENSMUST00000218788
AA Change: N446I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219310
Predicted Effect probably benign
Transcript: ENSMUST00000219393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220030
Predicted Effect probably benign
Transcript: ENSMUST00000220228
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A C 3: 127,016,964 I491S probably damaging Het
Armc12 A T 17: 28,538,614 Q240L probably null Het
Cntnap5c C T 17: 58,330,277 P1050S probably damaging Het
Col4a3 C A 1: 82,641,476 A42E unknown Het
D630003M21Rik A G 2: 158,220,516 V28A probably damaging Het
Dbf4 A G 5: 8,398,143 S355P probably damaging Het
Dnah6 A G 6: 73,173,533 V749A probably benign Het
Exoc4 T C 6: 33,815,753 L606P probably damaging Het
Fggy T C 4: 95,600,973 S109P probably benign Het
Gdf7 T A 12: 8,301,758 Q59L unknown Het
M6pr T C 6: 122,313,390 V104A probably damaging Het
Macf1 A T 4: 123,470,946 probably null Het
Micu2 T C 14: 57,943,670 K169R probably damaging Het
Mthfd1l A G 10: 4,047,937 D636G probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nfib T G 4: 82,498,471 D125A probably damaging Het
Nuf2 T C 1: 169,504,548 T393A probably benign Het
Olfr913 G A 9: 38,594,964 V248I possibly damaging Het
Paox T A 7: 140,126,378 N70K probably damaging Het
Pnmal2 A G 7: 16,945,919 N276S probably damaging Het
Ralgds G A 2: 28,533,644 A32T probably damaging Het
Soat1 T C 1: 156,466,492 probably null Het
Tmem87a A T 2: 120,375,477 V339E possibly damaging Het
Tmprss13 G T 9: 45,345,305 C516F probably damaging Het
Vmn2r69 T C 7: 85,409,809 T515A probably benign Het
Xrcc5 T C 1: 72,312,593 probably null Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Zfp964 G T 8: 69,662,983 D78Y probably damaging Het
Other mutations in Samd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1921:Samd11 UTSW 4 156248709 missense probably damaging 1.00
R3710:Samd11 UTSW 4 156250495 missense probably damaging 1.00
R4169:Samd11 UTSW 4 156247746 missense probably damaging 1.00
R4249:Samd11 UTSW 4 156250486 missense probably damaging 1.00
R4586:Samd11 UTSW 4 156249432 missense probably damaging 1.00
R4735:Samd11 UTSW 4 156248773 missense probably benign
R4794:Samd11 UTSW 4 156249465 missense probably damaging 0.98
R6481:Samd11 UTSW 4 156249078 unclassified probably null
R7165:Samd11 UTSW 4 156252290 missense probably benign
R7357:Samd11 UTSW 4 156255007 intron probably null
R7402:Samd11 UTSW 4 156248773 missense probably benign
R7426:Samd11 UTSW 4 156249400 missense probably benign
R7645:Samd11 UTSW 4 156255183 start gained probably benign
R7761:Samd11 UTSW 4 156247825 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGCCACCTACAAAGAGACG -3'
(R):5'- ATGTCTGCAACTTCGTGGG -3'

Sequencing Primer
(F):5'- CGAAGCTGGGTGAATACCTGC -3'
(R):5'- AGGTCCCTAGGGTTCTGGC -3'
Posted On2018-06-22